SZGR2

Summary ?

GeneID	1021
Symbol	CDK6
Synonyms	MCPH12\|PLSTIRE
Description	cyclin-dependent kinase 6
Reference	MIM:603368\|HGNC:HGNC:1777\|Ensembl:ENSG00000105810\|HPRD:04533\|Vega:OTTHUMG00000131697
Gene type	protein-coding
Map location	7q21-q22
Pascal p-value	0.643
Fetal beta	1.445
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1642

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg26582784	7	92465342	CDK6	5.47E-11	-0.014	4.23E-7	DMG:Jaffe_2016
cg11038280	7	92466132	CDK6	5.27E-8	-0.011	1.38E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AP3M1	0.92	0.91
DHX15	0.92	0.92
HNRNPK	0.92	0.92
GMPS	0.92	0.92
MCPH1	0.92	0.92
PPM1D	0.92	0.92
COIL	0.92	0.91
CDC5L	0.92	0.92
INTS7	0.92	0.90
CRNKL1	0.92	0.92

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.70	-0.87
AF347015.31	-0.69	-0.85
MT-CYB	-0.67	-0.83
AF347015.33	-0.67	-0.82
FXYD1	-0.67	-0.83
IFI27	-0.66	-0.81
AF347015.8	-0.66	-0.84
AF347015.27	-0.66	-0.81
AIFM3	-0.65	-0.74
HLA-F	-0.65	-0.73

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004693	cyclin-dependent protein kinase activity	IEA	neuron (GO term level: 8)	-
GO:0000166	nucleotide binding	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0030332	cyclin binding	IPI		8114739
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042063	gliogenesis	IMP	neurogenesis, Glial (GO term level: 7)	12861051
GO:0000080	G1 phase of mitotic cell cycle	IEP		8114739
GO:0001954	positive regulation of cell-matrix adhesion	IDA		10205165
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0007049	cell cycle	IEA		-
GO:0010468	regulation of gene expression	IDA		15254224
GO:0010468	regulation of gene expression	IMP		17420273
GO:0051301	cell division	IEA		-
GO:0030097	hemopoiesis	IEA		-
GO:0045646	regulation of erythrocyte differentiation	IMP		12833137
GO:0048146	positive regulation of fibroblast proliferation	IMP		17420273
GO:0050680	negative regulation of epithelial cell proliferation	IMP		14985467
GO:0043697	cell dedifferentiation	IMP		12861051
GO:0045668	negative regulation of osteoblast differentiation	IDA		15254224
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000307	cyclin-dependent protein kinase holoenzyme complex	IDA		17420273
GO:0001726	ruffle	IDA		10205165
GO:0005634	nucleus	IDA		14985467 \|18029348
GO:0005737	cytoplasm	IDA		14985467 \|18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	Affinity Capture-Western Reconstituted Complex	BioGRID	10580009 \|11360184
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	-	HPRD	11739795
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	CCND1 (cyclin D1) interacts with CDK6.	BIND	12867429
CCND2	KIAK0002 \| MGC102758	cyclin D2	-	HPRD,BioGRID	11358847
CCND3	-	cyclin D3	-	HPRD,BioGRID	8114739 \|11360184
CDK2	p33(CDK2)	cyclin-dependent kinase 2	Co-purification	BioGRID	10934208
CDK6	MGC59692 \| PLSTIRE \| STQTL11	cyclin-dependent kinase 6	-	HPRD	11124804
CDK7	CAK1 \| CDKN7 \| MO15 \| STK1 \| p39MO15	cyclin-dependent kinase 7	CAK phosphorylates CDK6. This interaction was modeled on a demonstrated interaction between human CAK and CDK6 from an unspecified species.	BIND	7629134
CDKN1B	CDKN4 \| KIP1 \| MEN1B \| MEN4 \| P27KIP1	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	Affinity Capture-Western	BioGRID	11360184
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	CDKN2A interacts with CDK6	BIND	11556834
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	p16 interacts with CDK6. This interaction was modeled on a demonstrated interaction between human p16 and CDK6 from an unspecified species.	BIND	10491434
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	p16 interacts with cdk6. This interaction was modeled on a demonstrated interaction between human p16 and cdk6 from an unspecified species.	BIND	9482104
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	p16 interacts with cdk6.	BIND	8805225
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	-	HPRD,BioGRID	9751050
CDKN2C	INK4C \| p18 \| p18-INK4C	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	-	HPRD,BioGRID	8001816
CDKN2C	INK4C \| p18 \| p18-INK4C	cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)	An unspecified isoform of p18 interacts with cdk6. This interaction was modeled on a demonstrated interaction between human p18 and cdk6 from an unspecified species.	BIND	9482104
CDKN2D	INK4D \| p19 \| p19-INK4D	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)	-	HPRD,BioGRID	9751050\|9751051
CNOT7	CAF1 \| hCAF-1	CCR4-NOT transcription complex, subunit 7	-	HPRD	10602502
MCM10	CNA43 \| DNA43 \| MGC126776 \| PRO2249	minichromosome maintenance complex component 10	-	HPRD	15232106
PCNA	MGC8367	proliferating cell nuclear antigen	-	HPRD	9667749
PPM1B	MGC21657 \| PP2C-beta-X \| PP2CB \| PP2CBETA \| PPC2BETAX	protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform	-	HPRD,BioGRID	10934208
PPP2CA	PP2Ac \| PP2CA \| RP-C	protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform	Biochemical Activity Co-purification	BioGRID	10934208
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	CDK6 phosphorylates Rb. This interaction was modeled on a demonstrated interaction between CDK6 and Rb, both from an unspecified species.	BIND	7629134
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Cdk6 phosphorylates Rb	BIND	10339564

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG P53 SIGNALING PATHWAY	69	45	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
KEGG GLIOMA	65	56	All SZGR 2.0 genes in this pathway
KEGG MELANOMA	71	57	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
KEGG NON SMALL CELL LUNG CANCER	54	47	All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY	28	21	All SZGR 2.0 genes in this pathway
BIOCARTA CELLCYCLE PATHWAY	23	15	All SZGR 2.0 genes in this pathway
BIOCARTA RACCYCD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
PID P73PATHWAY	79	59	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID RB 1PATHWAY	65	46	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE MITOTIC	325	185	All SZGR 2.0 genes in this pathway
REACTOME G1 PHASE	38	23	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC G1 G1 S PHASES	137	79	All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN	391	222	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION GRANULOCYTE UP	55	34	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP	316	190	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA DN	77	52	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
NUNODA RESPONSE TO DASATINIB IMATINIB UP	29	20	All SZGR 2.0 genes in this pathway
SNIJDERS AMPLIFIED IN HEAD AND NECK TUMORS	37	27	All SZGR 2.0 genes in this pathway
AMUNDSON RESPONSE TO ARSENITE	217	143	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP	176	111	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS	148	97	All SZGR 2.0 genes in this pathway
HE PTEN TARGETS UP	16	15	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU UP	53	37	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 7Q21 Q22 AMPLICON	76	33	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA COPY NUMBER UP	75	36	All SZGR 2.0 genes in this pathway
YAGI AML RELAPSE PROGNOSIS	35	24	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 DN	51	32	All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL	129	87	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
MARIADASON RESPONSE TO BUTYRATE SULINDAC 6	52	32	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 8G	95	62	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 2D DN	64	35	All SZGR 2.0 genes in this pathway
WHITEFORD PEDIATRIC CANCER MARKERS	116	63	All SZGR 2.0 genes in this pathway
BRUECKNER TARGETS OF MIRLET7A3 UP	111	69	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
LEE INTRATHYMIC T PROGENITOR	21	14	All SZGR 2.0 genes in this pathway
MIKKELSEN PLURIPOTENT STATE DN	8	7	All SZGR 2.0 genes in this pathway
SHAFFER IRF4 MULTIPLE MYELOMA PROGRAM	36	25	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP	176	110	All SZGR 2.0 genes in this pathway
ONO AML1 TARGETS DN	41	25	All SZGR 2.0 genes in this pathway
ONO FOXP3 TARGETS DN	42	23	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP	80	54	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S2	115	74	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR DN	91	56	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
CARD MIR302A TARGETS	77	62	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 DN	88	61	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 DN	82	51	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS	206	127	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2	57	39	All SZGR 2.0 genes in this pathway
GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION	40	28	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway
BOSCO TH1 CYTOTOXIC MODULE	114	62	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP	289	184	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	8950	8957	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-101	7946	7952	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-103/107	309	315	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	309	315	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-124.1	1648	1654	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1648	1654	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1648	1654	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-137	7133	7139	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-141/200a	470	476	1A	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	470	476	1A	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-145	9863	9869	m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-214	267	273	1A	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-25/32/92/363/367	7113	7119	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-26	7079	7086	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
				hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-29	9880	9886	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
				hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-320	193	200	1A,m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-33	7111	7117	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
				hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
				hsa-miR-33	GUGCAUUGUAGUUGCAUUG
				hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-330	9132	9139	1A,m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-34/449	9172	9178	m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-34b	9173	9179	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-494	229	235	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-495	210	216	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-495	210	216	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CDK6