Gene Page: CSE1L
Summary ?
GeneID | 1434 |
Symbol | CSE1L |
Synonyms | CAS|CSE1|XPO2 |
Description | CSE1 chromosome segregation 1-like (yeast) |
Reference | MIM:601342|HGNC:HGNC:2431|Ensembl:ENSG00000124207|HPRD:03217|Vega:OTTHUMG00000033046 |
Gene type | protein-coding |
Map location | 20q13 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.594 |
Fetal beta | 2.028 |
DMG | 1 (# studies) |
eGene | Meta |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanNRC CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0208 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg26206598 | 20 | 47445432 | CSE1L | 0.003 | 2.496 | DMG:vanEijk_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RBM15B | 0.97 | 0.97 |
MARCKSL1 | 0.96 | 0.92 |
AC004471.2 | 0.96 | 0.93 |
DBN1 | 0.96 | 0.95 |
TSSK2 | 0.96 | 0.93 |
KDM2B | 0.96 | 0.95 |
JUP | 0.95 | 0.92 |
ZNF48 | 0.95 | 0.95 |
SEMA4C | 0.95 | 0.93 |
ZBTB12 | 0.95 | 0.94 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.75 | -0.77 |
AF347015.27 | -0.75 | -0.91 |
AF347015.31 | -0.74 | -0.90 |
HLA-F | -0.73 | -0.75 |
MT-CO2 | -0.73 | -0.90 |
AF347015.33 | -0.72 | -0.87 |
S100B | -0.72 | -0.83 |
AIFM3 | -0.72 | -0.73 |
ALDOC | -0.71 | -0.70 |
MT-CYB | -0.71 | -0.87 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 17719542 | |
GO:0008262 | importin-alpha export receptor activity | TAS | 9323134 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000059 | protein import into nucleus, docking | IEA | - | |
GO:0008283 | cell proliferation | TAS | 7479798 | |
GO:0006915 | apoptosis | TAS | 7479798 | |
GO:0006886 | intracellular protein transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | TAS | 9323134 | |
GO:0005643 | nuclear pore | IEA | - | |
GO:0005737 | cytoplasm | TAS | 9323134 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
CDH1 | Arc-1 | CD324 | CDHE | ECAD | LCAM | UVO | cadherin 1, type 1, E-cadherin (epithelial) | - | HPRD,BioGRID | 12061792 |
HNRNPL | FLJ35509 | HNRPL | P/OKcl.14 | hnRNP-L | heterogeneous nuclear ribonucleoprotein L | Two-hybrid | BioGRID | 16169070 |
IKBKG | AMCBX1 | FIP-3 | FIP3 | Fip3p | IKK-gamma | IP | IP1 | IP2 | IPD2 | NEMO | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma | - | HPRD | 14743216 |
KPNA1 | IPOA5 | NPI-1 | RCH2 | SRP1 | karyopherin alpha 1 (importin alpha 5) | Reconstituted Complex | BioGRID | 10523667 |
KPNA2 | IPOA1 | QIP2 | RCH1 | SRP1alpha | karyopherin alpha 2 (RAG cohort 1, importin alpha 1) | Reconstituted Complex | BioGRID | 9323134 |10523667 |
KPNA4 | IPOA3 | MGC12217 | MGC26703 | QIP1 | SRP3 | karyopherin alpha 4 (importin alpha 3) | Reconstituted Complex | BioGRID | 10523667 |
KPNA6 | FLJ11249 | IPOA7 | KPNA7 | MGC17918 | karyopherin alpha 6 (importin alpha 7) | - | HPRD | 10523667 |
PPP5C | FLJ36922 | PP5 | PPP5 | protein phosphatase 5, catalytic subunit | Two-hybrid | BioGRID | 16169070 |
RAN | ARA24 | Gsp1 | TC4 | RAN, member RAS oncogene family | - | HPRD | 9323134 |
RPL22 | EAP | HBP15 | HBP15/L22 | ribosomal protein L22 | Two-hybrid | BioGRID | 16169070 |
STAT1 | DKFZp686B04100 | ISGF-3 | STAT91 | signal transducer and activator of transcription 1, 91kDa | - | HPRD | 11927559 |
TMEM62 | FLJ23375 | transmembrane protein 62 | Two-hybrid | BioGRID | 16169070 |
TNFRSF1B | CD120b | TBPII | TNF-R-II | TNF-R75 | TNFBR | TNFR1B | TNFR2 | TNFR80 | p75 | p75TNFR | tumor necrosis factor receptor superfamily, member 1B | - | HPRD | 14743216 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD | 15324660 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
PID P53 REGULATION PATHWAY | 59 | 50 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
HUMMEL BURKITTS LYMPHOMA UP | 43 | 27 | All SZGR 2.0 genes in this pathway |
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP | 181 | 101 | All SZGR 2.0 genes in this pathway |
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING DN | 87 | 49 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS UP | 214 | 134 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS UP | 293 | 179 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
CHIN BREAST CANCER COPY NUMBER UP | 27 | 18 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID WITH 7Q DELETION UP | 67 | 37 | All SZGR 2.0 genes in this pathway |
OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
MISSIAGLIA REGULATED BY METHYLATION DN | 122 | 67 | All SZGR 2.0 genes in this pathway |
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP UP | 69 | 40 | All SZGR 2.0 genes in this pathway |
SEIDEN MET SIGNALING | 19 | 16 | All SZGR 2.0 genes in this pathway |
SCHLOSSER MYC TARGETS AND SERUM RESPONSE DN | 47 | 34 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH PROLIFERATION | 147 | 80 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
KENNY CTNNB1 TARGETS UP | 50 | 30 | All SZGR 2.0 genes in this pathway |
BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
SANA RESPONSE TO IFNG DN | 85 | 56 | All SZGR 2.0 genes in this pathway |
PEART HDAC PROLIFERATION CLUSTER DN | 76 | 57 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION DN | 87 | 57 | All SZGR 2.0 genes in this pathway |
XU RESPONSE TO TRETINOIN AND NSC682994 DN | 15 | 12 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 4 | 48 | 32 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR UP | 93 | 65 | All SZGR 2.0 genes in this pathway |
LY AGING OLD DN | 56 | 35 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA | 51 | 35 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS SIGNALING DN | 72 | 47 | All SZGR 2.0 genes in this pathway |
SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP | 83 | 63 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR DN | 251 | 151 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S2 | 115 | 74 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS UP | 84 | 51 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
ZHOU CELL CYCLE GENES IN IR RESPONSE 24HR | 128 | 73 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-137 | 482 | 488 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.