Gene Page: DDX5
Summary ?
GeneID | 1655 |
Symbol | DDX5 |
Synonyms | G17P1|HLR1|HUMP68|p68 |
Description | DEAD-box helicase 5 |
Reference | MIM:180630|HGNC:HGNC:2746|Ensembl:ENSG00000108654|HPRD:01615|Vega:OTTHUMG00000178936 |
Gene type | protein-coding |
Map location | 17q21 |
Pascal p-value | 0.452 |
Sherlock p-value | 0.521 |
Fetal beta | 0.76 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0876 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg23225508 | 17 | 62500377 | DDX5 | 1.56E-5 | 0.618 | 0.015 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs3217906 | chr12 | 4405803 | DDX5 | 1655 | 0.17 | trans | ||
rs3217933 | chr12 | 4412999 | DDX5 | 1655 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003712 | transcription cofactor activity | IEA | - | |
GO:0003723 | RNA binding | IEA | - | |
GO:0003724 | RNA helicase activity | NAS | 1996094 | |
GO:0005515 | protein binding | IPI | 17220478 |17353931 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0016818 | hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides | IEA | - | |
GO:0008026 | ATP-dependent helicase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006397 | mRNA processing | IEA | - | |
GO:0008380 | RNA splicing | IEA | - | |
GO:0016049 | cell growth | NAS | 2451786 | |
GO:0045941 | positive regulation of transcription | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | NAS | 2451786 | |
GO:0005681 | spliceosome | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AKAP8 | AKAP95 | DKFZp586B1222 | A kinase (PRKA) anchor protein 8 | - | HPRD,BioGRID | 11279182 |
CDKN1A | CAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1 | cyclin-dependent kinase inhibitor 1A (p21, Cip1) | p68 interacts with the p21 promoter. | BIND | 15660129 |
CREBBP | CBP | KAT3A | RSTS | CREB binding protein | - | HPRD,BioGRID | 12527917 |
DDX17 | DKFZp761H2016 | P72 | RH70 | DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 | p72 interacts with p68. | BIND | 12595555 |
EP300 | KAT3B | p300 | E1A binding protein p300 | Affinity Capture-Western | BioGRID | 12527917 |
ESR1 | DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1 | estrogen receptor 1 | Affinity Capture-Western Two-hybrid | BioGRID | 10409727 |
ESR1 | DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1 | estrogen receptor 1 | ESR1 (ER-alpha) interacts with DDX5 (p68). This interaction was modeled on a demonstrated interaction between ESR1 from an unspecified species and DDX5 from an unspecified species. | BIND | 12738788 |
FBL | FIB | FLRN | RNU3IP1 | fibrillarin | - | HPRD,BioGRID | 10837141 |
HDAC1 | DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 | histone deacetylase 1 | Affinity Capture-Western | BioGRID | 15298701 |
MAP3K7 | TAK1 | TGF1a | mitogen-activated protein kinase kinase kinase 7 | - | HPRD | 14743216 |
STK24 | MST-3 | MST3 | MST3B | STE20 | STK3 | serine/threonine kinase 24 (STE20 homolog, yeast) | Affinity Capture-MS | BioGRID | 17353931 |
TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | p68 interacts with p53. | BIND | 15660129 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG SPLICEOSOME | 128 | 72 | All SZGR 2.0 genes in this pathway |
BIOCARTA AKAP95 PATHWAY | 12 | 9 | All SZGR 2.0 genes in this pathway |
PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON | 335 | 181 | All SZGR 2.0 genes in this pathway |
ZUCCHI METASTASIS DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR DN | 41 | 30 | All SZGR 2.0 genes in this pathway |
KENNY CTNNB1 TARGETS DN | 52 | 34 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
STONER ESOPHAGEAL CARCINOGENESIS UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
LEE AGING MUSCLE UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE DN | 181 | 97 | All SZGR 2.0 genes in this pathway |
ONO AML1 TARGETS UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
ONO FOXP3 TARGETS UP | 23 | 15 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS UP | 143 | 100 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
CARD MIR302A TARGETS | 77 | 62 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
ABRAMSON INTERACT WITH AIRE | 45 | 33 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 163 | 169 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-141/200a | 211 | 217 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-142-5p | 43 | 49 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-17-5p/20/93.mr/106/519.d | 129 | 135 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-205 | 257 | 263 | m8 | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
miR-324-3p | 209 | 215 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
miR-325 | 195 | 201 | 1A | hsa-miR-325 | CCUAGUAGGUGUCCAGUAAGUGU |
miR-496 | 15 | 21 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-539 | 155 | 161 | m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-544 | 94 | 101 | 1A,m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.