SZGR2

Summary ?

GeneID	2048
Symbol	EPHB2
Synonyms	CAPB\|DRT\|EK5\|EPHT3\|ERK\|Hek5\|PCBC\|Tyro5
Description	EPH receptor B2
Reference	MIM:600997\|HGNC:HGNC:3393\|HPRD:02997\|
Gene type	protein-coding
Map location	1p36.1-p35
Pascal p-value	0.267
Sherlock p-value	0.58
Fetal beta	1.523
DMG	1 (# studies)
eGene	Caudate basal ganglia
Support	Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 7
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1976

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg18156963	1	23153308	EPHB2	1.95E-5	-0.297	0.016	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZNF444	0.83	0.87
PRAF2	0.82	0.83
EPN1	0.81	0.84
FBXW5	0.81	0.84
RNF126	0.81	0.83
ZNF580	0.80	0.84
PIM3	0.80	0.85
AC129492.2	0.80	0.82
C11orf68	0.79	0.82
DAPK3	0.79	0.82

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.53	-0.43
AF347015.8	-0.49	-0.41
AF347015.31	-0.49	-0.41
MT-CO2	-0.48	-0.39
MT-ATP8	-0.47	-0.45
AF347015.27	-0.46	-0.40
MT-CYB	-0.46	-0.38
AF347015.33	-0.45	-0.38
NOSTRIN	-0.45	-0.40
AF347015.18	-0.44	-0.38

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008046	axon guidance receptor activity	IEA	axon (GO term level: 6)	-
GO:0005102	receptor binding	IEA	Neurotransmitter (GO term level: 4)	-
GO:0000166	nucleotide binding	IEA		-
GO:0005005	transmembrane-ephrin receptor activity	TAS		8589679
GO:0004872	receptor activity	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007411	axon guidance	IEA	axon (GO term level: 13)	-
GO:0048170	positive regulation of long-term neuronal synaptic plasticity	IEA	neuron, neurogenesis, Synap (GO term level: 11)	-
GO:0048168	regulation of neuronal synaptic plasticity	IEA	neuron, Synap (GO term level: 9)	-
GO:0050770	regulation of axonogenesis	IEA	neuron, axon (GO term level: 13)	-
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	8589679
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	IEA		-
GO:0006468	protein amino acid phosphorylation	TAS		-
GO:0009887	organ morphogenesis	IEA		-
GO:0007612	learning	IEA		-
GO:0045786	negative regulation of cell cycle	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	TAS		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD,BioGRID	11494128
ACP1	HAAP \| MGC111030 \| MGC3499	acid phosphatase 1, soluble	-	HPRD,BioGRID	9499402
ADAM17	CD156b \| MGC71942 \| TACE \| cSVP	ADAM metallopeptidase domain 17	-	HPRD	12058067
BCL2	Bcl-2	B-cell CLL/lymphoma 2	Biochemical Activity	BioGRID	15225643
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	Reconstituted Complex	BioGRID	10644995
EFNB1	CFND \| CFNS \| EFL3 \| EPLG2 \| Elk-L \| LERK2 \| MGC8782	ephrin-B1	-	HPRD	8878483
EFNB1	CFND \| CFNS \| EFL3 \| EPLG2 \| Elk-L \| LERK2 \| MGC8782	ephrin-B1	The membrane bound ligand ELK-L interacts with the receptor NUK. This interaction was modeled on a demonstrated interaction between ELK-L from human and NUK from mouse.	BIND	8755474
EFNB2	EPLG5 \| HTKL \| Htk-L \| LERK5 \| MGC126226 \| MGC126227 \| MGC126228	ephrin-B2	The membrane bound ligand HTK-L interacts with the receptor NUK. This interaction was modeled on a demonstrated interaction between HTK-L from human and NUK from mouse.	BIND	8755474
EFNB2	EPLG5 \| HTKL \| Htk-L \| LERK5 \| MGC126226 \| MGC126227 \| MGC126228	ephrin-B2	-	HPRD,BioGRID	11780069
EPHB2	CAPB \| DRT \| EPHT3 \| ERK \| Hek5 \| MGC87492 \| PCBC \| Tyro5	EPH receptor B2	-	HPRD,BioGRID	9933164
GRIN1	NMDA1 \| NMDAR1 \| NR1	glutamate receptor, ionotropic, N-methyl D-aspartate 1	-	HPRD	11754835
ITSN1	ITSN \| MGC134948 \| MGC134949 \| SH3D1A \| SH3P17	intersectin 1 (SH3 domain protein)	-	HPRD,BioGRID	12389031
MLLT4	AF-6 \| AF6 \| AFADIN \| FLJ34371 \| RP3-431P23.3	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	EphB2 interacts with AF6. This interaction was modelled on a demonstrated interaction between EphB2 from human and mouse AF6.	BIND	9707552
MLLT4	AF-6 \| AF6 \| AFADIN \| FLJ34371 \| RP3-431P23.3	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	-	HPRD,BioGRID	9707552
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD	9233798
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD,BioGRID	9233798 \|10644995
RP6-213H19.1	MASK \| MST4	serine/threonine protein kinase MST4	Phenotypic Enhancement	BioGRID	11641781
RYK	D3S3195 \| JTK5 \| JTK5A \| RYK1	RYK receptor-like tyrosine kinase	-	HPRD,BioGRID	11956217
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	9632142

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
ST GA12 PATHWAY	23	16	All SZGR 2.0 genes in this pathway
ST G ALPHA I PATHWAY	35	29	All SZGR 2.0 genes in this pathway
ST GRANULE CELL SURVIVAL PATHWAY	27	23	All SZGR 2.0 genes in this pathway
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
ST T CELL SIGNAL TRANSDUCTION	45	33	All SZGR 2.0 genes in this pathway
ST B CELL ANTIGEN RECEPTOR	40	32	All SZGR 2.0 genes in this pathway
ST FAS SIGNALING PATHWAY	65	54	All SZGR 2.0 genes in this pathway
ST MYOCYTE AD PATHWAY	27	25	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID SYNDECAN 2 PATHWAY	33	27	All SZGR 2.0 genes in this pathway
PID EPHRINB REV PATHWAY	30	25	All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED DN	86	47	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN	126	86	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP	194	112	All SZGR 2.0 genes in this pathway
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN	45	34	All SZGR 2.0 genes in this pathway
XU HGF TARGETS INDUCED BY AKT1 48HR UP	14	8	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP	256	159	All SZGR 2.0 genes in this pathway
ONDER CDH1 SIGNALING VIA CTNNB1	83	58	All SZGR 2.0 genes in this pathway
SWEET KRAS TARGETS UP	84	51	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS UP	126	84	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP	56	35	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
VERRECCHIA DELAYED RESPONSE TO TGFB1	39	26	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C4	13	10	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR UP	148	96	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS	212	121	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC	210	123	All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC	58	43	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP	250	168	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP	285	167	All SZGR 2.0 genes in this pathway
HUANG DASATINIB RESISTANCE UP	81	53	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN	138	92	All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN	67	46	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE UP	181	106	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP	176	110	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP	259	159	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
PLASARI NFIC TARGETS BASAL DN	18	13	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR UP	33	25	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
ZWANG EGF PERSISTENTLY DN	61	36	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	1497	1504	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1497	1504	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-150	309	316	1A,m8	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-185	353	360	1A,m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-203.1	1012	1018	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-203.1	1012	1018	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-224	1071	1077	1A	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-24*	1076	1082	1A	hsa-miR-189	GUGCCUACUGAGCUGAUAUCAGU
miR-27	1498	1504	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1498	1504	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	888	895	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-448	1103	1109	m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-495	885	891	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
				hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
				hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-9	1177	1183	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EPHB2