Gene Page: GAD1
Summary ?
| GeneID | 2571 |
| Symbol | GAD1 |
| Synonyms | CPSQ1|GAD|SCP |
| Description | glutamate decarboxylase 1 |
| Reference | MIM:605363|HGNC:HGNC:4092|Ensembl:ENSG00000128683|HPRD:12011|Vega:OTTHUMG00000044175 |
| Gene type | protein-coding |
| Map location | 2q31 |
| Pascal p-value | 0.071 |
| Sherlock p-value | 0.177 |
| Fetal beta | -1.46 |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 31 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FUT1 | 0.81 | 0.68 |
| FIGN | 0.79 | 0.57 |
| OPRM1 | 0.76 | 0.66 |
| RNF220 | 0.75 | 0.40 |
| TCF7L2 | 0.74 | 0.55 |
| COL23A1 | 0.74 | 0.60 |
| EPHA1 | 0.73 | 0.24 |
| LHX9 | 0.73 | 0.01 |
| MAST4 | 0.72 | 0.52 |
| GBX2 | 0.72 | 0.35 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SLA | -0.29 | -0.28 |
| NEUROD6 | -0.28 | -0.36 |
| NEUROD2 | -0.27 | -0.32 |
| AC087491.1 | -0.27 | -0.44 |
| UXT | -0.27 | -0.51 |
| CSRP2 | -0.27 | -0.53 |
| KLHL1 | -0.27 | -0.23 |
| RPL37 | -0.27 | -0.59 |
| TMEM108 | -0.26 | -0.23 |
| TTC28 | -0.26 | -0.22 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004351 | glutamate decarboxylase activity | IDA | glutamate (GO term level: 6) | 10671565 |
| GO:0005515 | protein binding | IPI | 10671565 | |
| GO:0016829 | lyase activity | IEA | - | |
| GO:0016831 | carboxy-lyase activity | IEA | - | |
| GO:0030170 | pyridoxal phosphate binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 8954991 |
| GO:0006540 | glutamate decarboxylation to succinate | TAS | GABA, glutamate, Brain, Neurotransmitter (GO term level: 10) | 1549570 |
| GO:0042136 | neurotransmitter biosynthetic process | IEA | neuron, axon, Synap, Neurotransmitter (GO term level: 9) | - |
| GO:0018352 | protein-pyridoxal-5-phosphate linkage | TAS | 10671565 | |
| GO:0019752 | carboxylic acid metabolic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0012506 | vesicle membrane | NAS | 10671565 | |
| GO:0005622 | intracellular | IDA | 10671565 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ALANINE ASPARTATE AND GLUTAMATE METABOLISM | 32 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG BETA ALANINE METABOLISM | 22 | 16 | All SZGR 2.0 genes in this pathway |
| KEGG TAURINE AND HYPOTAURINE METABOLISM | 10 | 7 | All SZGR 2.0 genes in this pathway |
| KEGG BUTANOATE METABOLISM | 34 | 20 | All SZGR 2.0 genes in this pathway |
| KEGG TYPE I DIABETES MELLITUS | 44 | 38 | All SZGR 2.0 genes in this pathway |
| BIOCARTA NEUROTRANSMITTERS PATHWAY | 6 | 5 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RELEASE CYCLE | 34 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME GABA SYNTHESIS RELEASE REUPTAKE AND DEGRADATION | 17 | 16 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
| WATANABE COLON CANCER MSI VS MSS UP | 29 | 18 | All SZGR 2.0 genes in this pathway |
| DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
| OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| APPIERTO RESPONSE TO FENRETINIDE UP | 38 | 26 | All SZGR 2.0 genes in this pathway |
| SEITZ NEOPLASTIC TRANSFORMATION BY 8P DELETION DN | 30 | 25 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
| WANG HCP PROSTATE CANCER | 111 | 69 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
| ROZANOV MMP14 TARGETS DN | 35 | 22 | All SZGR 2.0 genes in this pathway |
| CHESLER BRAIN D6MIT150 QTL TRANS | 9 | 7 | All SZGR 2.0 genes in this pathway |
| YU MYC TARGETS DN | 55 | 38 | All SZGR 2.0 genes in this pathway |
| YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY NO BLOOD DN | 150 | 93 | All SZGR 2.0 genes in this pathway |
| MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
| LOPES METHYLATED IN COLON CANCER UP | 27 | 20 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| HUPER BREAST BASAL VS LUMINAL DN | 59 | 44 | All SZGR 2.0 genes in this pathway |
| HUNSBERGER EXERCISE REGULATED GENES | 31 | 26 | All SZGR 2.0 genes in this pathway |
| HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE UP | 43 | 34 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
| HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| MADAN DPPA4 TARGETS | 46 | 26 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 1197 | 1203 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-146 | 1016 | 1022 | 1A | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
| hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
| miR-19 | 192 | 198 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-24 | 824 | 830 | 1A | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
| miR-381 | 739 | 745 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-410 | 773 | 779 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-493-5p | 216 | 222 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-9 | 828 | 834 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.