Gene Page: SACS
Summary ?
GeneID | 26278 |
Symbol | SACS |
Synonyms | ARSACS|DNAJC29|PPP1R138|SPAX6 |
Description | sacsin molecular chaperone |
Reference | MIM:604490|HGNC:HGNC:10519|Ensembl:ENSG00000151835|HPRD:05135|Vega:OTTHUMG00000016562 |
Gene type | protein-coding |
Map location | 13q12 |
Pascal p-value | 0.002 |
eGene | Cerebellar Hemisphere Myers' cis & trans |
Support | RNA AND PROTEIN SYNTHESIS |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0333 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1341306 | chr1 | 18564668 | SACS | 26278 | 0.07 | trans | ||
rs823066 | chr1 | 205771172 | SACS | 26278 | 0.03 | trans | ||
rs9882137 | chr3 | 29494146 | SACS | 26278 | 0 | trans | ||
rs9882501 | chr3 | 29494429 | SACS | 26278 | 0.08 | trans | ||
rs4491879 | chr3 | 189373908 | SACS | 26278 | 0.14 | trans | ||
rs4505678 | chr3 | 189374356 | SACS | 26278 | 0.11 | trans | ||
snp_a-2169623 | 0 | SACS | 26278 | 0.07 | trans | |||
rs9257144 | chr6 | 28729980 | SACS | 26278 | 0.09 | trans | ||
rs16894557 | chr6 | 28999825 | SACS | 26278 | 0.04 | trans | ||
rs4947631 | chr7 | 50603378 | SACS | 26278 | 0.04 | trans | ||
rs17139868 | chr7 | 117079228 | SACS | 26278 | 0.15 | trans | ||
rs1800130 | chr7 | 117282643 | SACS | 26278 | 0.15 | trans | ||
rs2195588 | chr8 | 40356699 | SACS | 26278 | 0.07 | trans | ||
rs16908892 | chr9 | 122499151 | SACS | 26278 | 0.15 | trans | ||
rs12554113 | chr9 | 122523558 | SACS | 26278 | 0.18 | trans | ||
rs917836 | chr18 | 20053367 | SACS | 26278 | 0.09 | trans | ||
rs1503026 | chr18 | 70842605 | SACS | 26278 | 0.05 | trans | ||
rs12326929 | chr18 | 70864592 | SACS | 26278 | 0.01 | trans | ||
rs12327665 | chr19 | 39622639 | SACS | 26278 | 0.11 | trans | ||
rs6040607 | chr20 | 11371092 | SACS | 26278 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003674 | molecular_function | ND | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0031072 | heat shock protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006457 | protein folding | NAS | 10655055 | |
GO:0006464 | protein modification process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE UP | 85 | 57 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
KAN RESPONSE TO ARSENIC TRIOXIDE | 123 | 80 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
WU CELL MIGRATION | 184 | 114 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER METASTASIS DN | 121 | 65 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 DN | 163 | 115 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR DN | 47 | 31 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
BILD SRC ONCOGENIC SIGNATURE | 62 | 38 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS RESPONSIVE TO ESTROGEN DN | 41 | 26 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
CHEOK RESPONSE TO MERCAPTOPURINE AND HD MTX DN | 25 | 18 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 ICP WITH H3K27ME3 | 74 | 46 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF ICP WITH H3K4ME3 AND H3K27ME3 | 38 | 34 | All SZGR 2.0 genes in this pathway |
STEIN ESR1 TARGETS | 85 | 55 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 6 | 29 | 20 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 863 | 869 | 1A | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-142-5p | 264 | 271 | 1A,m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-17-5p/20/93.mr/106/519.d | 262 | 269 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-183 | 1269 | 1276 | 1A,m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-199 | 377 | 384 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-218 | 100 | 106 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-223 | 1010 | 1017 | 1A,m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
miR-23 | 1232 | 1238 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-26 | 556 | 562 | m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-324-5p | 837 | 843 | 1A | hsa-miR-324-5p | CGCAUCCCCUAGGGCAUUGGUGU |
miR-543 | 1198 | 1204 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-9 | 274 | 280 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.