SZGR2

Summary ?

GeneID	3655
Symbol	ITGA6
Synonyms	CD49f\|ITGA6B\|VLA-6
Description	integrin subunit alpha 6
Reference	MIM:147556\|HGNC:HGNC:6142\|Ensembl:ENSG00000091409\|HPRD:00945\|Vega:OTTHUMG00000132277
Gene type	protein-coding
Map location	2q31.1
Pascal p-value	0.984
Fetal beta	-0.288
DMG	1 (# studies)
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
DNM:Ambalavanan_2016	Whole Exome Sequencing	This dataset includes 20 de novo mutations detected in 17 COS probands.
DNM:Xu_2012	Whole Exome Sequencing analysis	De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression	Meta-analysis of gene expression	P value: 1.606
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
ITGA6	chr2	173368885..173368888	AAAG	A	NM_000210 NM_001079818	. .	3-UTR out-of-frame-codon-deletion			Schizophrenia	DNM:Xu_2012
ITGA6	chr2	173368886_173368888	AAG	-	NM_001079818	p.(Glu1063del)	Deletion			Childhood-onset schizophrenia	DNM:Ambalavanan_2016

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg10749011	2	173292579	ITGA6		-0.019	0.53	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PTPRJ	0.81	0.85
PHLPP2	0.81	0.84
KIAA1467	0.79	0.84
DNAJC16	0.79	0.84
HSPA12A	0.78	0.81
SLC23A2	0.78	0.81
BTBD9	0.78	0.84
LMTK2	0.78	0.84
TGOLN2	0.78	0.82
HTT	0.78	0.82

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.48	-0.51
C1orf54	-0.47	-0.58
HIGD1B	-0.47	-0.52
AF347015.31	-0.46	-0.50
C1orf61	-0.46	-0.60
AP002478.3	-0.45	-0.51
MT-CO2	-0.45	-0.51
GNG11	-0.45	-0.52
FXYD1	-0.44	-0.47
RAB34	-0.44	-0.52

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	IEA		-
GO:0007229	integrin-mediated signaling pathway	IEA		-
GO:0007044	cell-substrate junction assembly	TAS		9185503
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0008305	integrin complex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CANX	CNX \| FLJ26570 \| IP90 \| P90	calnexin	-	HPRD	8163531
CD36	CHDS7 \| FAT \| GP3B \| GP4 \| GPIV \| PASIV \| SCARB3	CD36 molecule (thrombospondin receptor)	Affinity Capture-Western	BioGRID	11238109
CD63	LAMP-3 \| ME491 \| MLA1 \| OMA81H \| TSPAN30	CD63 molecule	-	HPRD,BioGRID	7629079
CD82	4F9 \| C33 \| GR15 \| IA4 \| KAI1 \| R2 \| SAR2 \| ST6 \| TSPAN27	CD82 molecule	-	HPRD	8757325
COL17A1	BA16H23.2 \| BP180 \| BPAG2 \| FLJ60881 \| KIAA0204 \| LAD-1	collagen, type XVII, alpha 1	-	HPRD	9500991 \|11739652
GIPC1	C19orf3 \| GIPC \| GLUT1CBP \| Hs.6454 \| IIP-1 \| MGC15889 \| MGC3774 \| NIP \| RGS19IP1 \| SEMCAP \| SYNECTIIN \| SYNECTIN \| TIP-2	GIPC PDZ domain containing family, member 1	-	HPRD,BioGRID	11479315
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD	7556090
ITGB1	CD29 \| FNRB \| GPIIA \| MDF2 \| MSK12 \| VLA-BETA \| VLAB	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	Affinity Capture-Western	BioGRID	9660880
ITGB1	CD29 \| FNRB \| GPIIA \| MDF2 \| MSK12 \| VLA-BETA \| VLAB	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	-	HPRD	9425259
ITGB1	CD29 \| FNRB \| GPIIA \| MDF2 \| MSK12 \| VLA-BETA \| VLAB	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	VLA6-alpha6 interacts with VLA-beta1.	BIND	1690718 \|1693624 \|2138612 \|2649503 \|2967289
ITGB4	CD104	integrin, beta 4	-	HPRD	9660880
ITGB4	CD104	integrin, beta 4	VLA6-alpha6 interacts with Integrin-beta4.	BIND	1693624 \|2138612 \|2649503
PXN	FLJ16691	paxillin	-	HPRD,BioGRID	12033289
RPSA	37LRP \| 67LR \| LAMBR \| LAMR1 \| LRP \| p40	ribosomal protein SA	in vivo	BioGRID	10477615
TSPAN4	NAG-2 \| NAG2 \| TETRASPAN \| TM4SF7 \| TSPAN-4	tetraspanin 4	-	HPRD,BioGRID	9360996

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG ECM RECEPTOR INTERACTION	84	53	All SZGR 2.0 genes in this pathway
KEGG CELL ADHESION MOLECULES CAMS	134	93	All SZGR 2.0 genes in this pathway
KEGG HEMATOPOIETIC CELL LINEAGE	88	60	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM	85	65	All SZGR 2.0 genes in this pathway
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC	76	59	All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY	92	68	All SZGR 2.0 genes in this pathway
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
PID INTEGRIN1 PATHWAY	66	44	All SZGR 2.0 genes in this pathway
PID INTEGRIN CS PATHWAY	26	16	All SZGR 2.0 genes in this pathway
PID ARF6 TRAFFICKING PATHWAY	49	34	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID INTEGRIN4 PATHWAY	11	5	All SZGR 2.0 genes in this pathway
PID A6B1 A6B4 INTEGRIN PATHWAY	46	35	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN	187	115	All SZGR 2.0 genes in this pathway
DITTMER PTHLH TARGETS DN	73	51	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
SENESE HDAC2 TARGETS UP	114	66	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP	137	84	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN DN	27	20	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 UP	58	39	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP	126	72	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP	612	367	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
SEIDEN ONCOGENESIS BY MET	88	53	All SZGR 2.0 genes in this pathway
NAISHIRO CTNNB1 TARGETS WITH LEF1 MOTIF	8	7	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 DN	66	38	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE NORMAL DN	33	27	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE IMMORTALIZED DN	31	26	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 DN	156	106	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 480 HELA	164	118	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS B LYMPHOCYTE UP	78	51	All SZGR 2.0 genes in this pathway
SANA TNF SIGNALING DN	90	57	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
ABBUD LIF SIGNALING 1 DN	26	17	All SZGR 2.0 genes in this pathway
XU RESPONSE TO TRETINOIN AND NSC682994 UP	17	13	All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL	50	35	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED DN	246	180	All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS	191	131	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS UP	206	118	All SZGR 2.0 genes in this pathway
TRAYNOR RETT SYNDROM DN	19	14	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN	58	43	All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF DN	84	50	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
ZHANG PROLIFERATING VS QUIESCENT	51	41	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D1	18	13	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C7	68	44	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 6	189	112	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4	94	69	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP	317	208	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP	461	298	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL DN	216	143	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
HUPER BREAST BASAL VS LUMINAL UP	54	29	All SZGR 2.0 genes in this pathway
JIANG TIP30 TARGETS UP	46	28	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D UP	89	62	All SZGR 2.0 genes in this pathway
GU PDEF TARGETS UP	71	49	All SZGR 2.0 genes in this pathway
FLOTHO PEDIATRIC ALL THERAPY RESPONSE UP	53	33	All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE UP	212	128	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
ZHAN EARLY DIFFERENTIATION GENES UP	7	6	All SZGR 2.0 genes in this pathway
ZHAN V1 LATE DIFFERENTIATION GENES UP	32	25	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 11	36	24	All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE UP	109	68	All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR DN	251	151	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 2HR DN	49	33	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BILANGES RAPAMYCIN SENSITIVE GENES	39	20	All SZGR 2.0 genes in this pathway
WINZEN DEGRADED VIA KHSRP	100	70	All SZGR 2.0 genes in this pathway
VANLOO SP3 TARGETS DN	89	47	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-129-5p	784	790	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	784	790	m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-143	1806	1813	1A,m8	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-186	212	218	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-19	175	182	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	175	182	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-26	613	619	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	613	619	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-29	1386	1392	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-30-5p	1565	1572	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-377	1915	1921	1A	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-381	636	642	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-381	636	642	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-450	784	790	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-9	695	701	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ITGA6