Gene Page: IRS1
Summary ?
| GeneID | 3667 |
| Symbol | IRS1 |
| Synonyms | HIRS-1 |
| Description | insulin receptor substrate 1 |
| Reference | MIM:147545|HGNC:HGNC:6125|Ensembl:ENSG00000169047|HPRD:00943|Vega:OTTHUMG00000133179 |
| Gene type | protein-coding |
| Map location | 2q36 |
| Pascal p-value | 0.008 |
| Fetal beta | 1.215 |
| DMG | 3 (# studies) |
| eGene | Myers' cis & trans |
| Support | G2Cdb.humanNRC G2Cdb.humanPSP CompositeSet Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 4 |
| DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 4 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 4 |
| DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0631 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| IRS1 | chr2 | 227661300 | C | T | NM_005544 | p.719E>K | missense | Schizophrenia | DNM:Xu_2012 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg14078053 | 2 | 227661656 | IRS1 | 2.15E-4 | 0.006 | 0.16 | DMG:Montano_2016 |
| cg04751089 | 2 | 227659636 | IRS1 | 1.095E-4 | 0.469 | 0.028 | DMG:Wockner_2014 |
| cg05263838 | 2 | 227659406 | IRS1 | 1.541E-4 | 0.778 | 0.032 | DMG:Wockner_2014 |
| cg03298167 | 2 | 227663911 | IRS1 | 5.11E-8 | -0.027 | 1.35E-5 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17088272 | chr18 | 71410110 | IRS1 | 3667 | 0.19 | trans | ||
| rs17088278 | chr18 | 71412692 | IRS1 | 3667 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RUVBL2 | 0.94 | 0.95 |
| C17orf49 | 0.93 | 0.94 |
| PSMB7 | 0.93 | 0.94 |
| PRMT1 | 0.93 | 0.95 |
| PSMA7 | 0.93 | 0.94 |
| TRIM39 | 0.93 | 0.92 |
| CLPP | 0.93 | 0.92 |
| ERGIC3 | 0.93 | 0.95 |
| RRP9 | 0.93 | 0.93 |
| DDX49 | 0.93 | 0.93 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.27 | -0.72 | -0.82 |
| AF347015.33 | -0.72 | -0.82 |
| AF347015.8 | -0.71 | -0.81 |
| MT-CO2 | -0.70 | -0.78 |
| MT-CYB | -0.70 | -0.81 |
| AF347015.15 | -0.70 | -0.82 |
| AF347015.26 | -0.69 | -0.84 |
| AF347015.31 | -0.69 | -0.77 |
| AF347015.2 | -0.69 | -0.81 |
| AF347015.9 | -0.65 | -0.78 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | TAS | 1311924 |8513971 | |
| GO:0005159 | insulin-like growth factor receptor binding | IPI | 7541045 | |
| GO:0005158 | insulin receptor binding | IPI | 7537849 |7559478 | |
| GO:0005069 | transmembrane receptor protein tyrosine kinase docking protein activity | TAS | 1648180 | |
| GO:0005515 | protein binding | IPI | 8388384 |9295312 |11018022 | |
| GO:0042169 | SH2 domain binding | ISS | - | |
| GO:0019901 | protein kinase binding | IEA | - | |
| GO:0043548 | phosphoinositide 3-kinase binding | IPI | 16043515 | |
| GO:0043548 | phosphoinositide 3-kinase binding | ISS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | TAS | 1311924 | |
| GO:0008286 | insulin receptor signaling pathway | IPI | 7537849 |7559478 | |
| GO:0048009 | insulin-like growth factor receptor signaling pathway | IPI | 7541045 | |
| GO:0043491 | protein kinase B signaling cascade | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005792 | microsome | ISS | - | |
| GO:0005634 | nucleus | ISS | - | |
| GO:0005737 | cytoplasm | ISS | - | |
| GO:0005901 | caveola | IDA | 15182363 | |
| GO:0005886 | plasma membrane | EXP | 12167717 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | - | HPRD,BioGRID | 10497255 |
| ALK | CD246 | Ki-1 | TFG/ALK | anaplastic lymphoma receptor tyrosine kinase | - | HPRD | 9174053 |
| AP3S1 | CLAPS3 | Sigma3A | adaptor-related protein complex 3, sigma 1 subunit | - | HPRD,BioGRID | 9792713 |
| ATP2A1 | ATP2A | SERCA1 | ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 | - | HPRD | 9295312 |
| BCL2 | Bcl-2 | B-cell CLL/lymphoma 2 | Affinity Capture-Western | BioGRID | 10679027 |
| BCL2L1 | BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xS | BCL2-like 1 | - | HPRD,BioGRID | 10679027 |
| CDH1 | Arc-1 | CD324 | CDHE | ECAD | LCAM | UVO | cadherin 1, type 1, E-cadherin (epithelial) | - | HPRD | 11035789 |
| CHUK | IKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16 | conserved helix-loop-helix ubiquitous kinase | - | HPRD,BioGRID | 12351658 |
| FRAP1 | FLJ44809 | FRAP | FRAP2 | MTOR | RAFT1 | RAPT1 | FK506 binding protein 12-rapamycin associated protein 1 | Affinity Capture-Western | BioGRID | 11287630 |
| GRB10 | GRB-IR | Grb-10 | IRBP | KIAA0207 | MEG1 | RSS | growth factor receptor-bound protein 10 | Reconstituted Complex | BioGRID | 8621530 |
| GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD | 7488107 |
| GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | Affinity Capture-Western Reconstituted Complex | BioGRID | 8491186 |8536716 |12173038 |
| IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | IGFIR interacts with IRS-1. | BIND | 7541045 |
| IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | IRS-1 interacts with IGF-IR. This interaction was modeled on a demonstrated interaction between rat IRS-1 and human IGF-IR. | BIND | 10026153 |
| IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | - | HPRD,BioGRID | 7559507 |
| IKBKB | FLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKB | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | Affinity Capture-Western | BioGRID | 12351658 |
| IKBKG | AMCBX1 | FIP-3 | FIP3 | Fip3p | IKK-gamma | IP | IP1 | IP2 | IPD2 | NEMO | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma | - | HPRD | 12351658 |
| IL4R | CD124 | IL4RA | interleukin 4 receptor | - | HPRD,BioGRID | 8599766 |
| INSR | CD220 | HHF5 | insulin receptor | IRS-1 interacts with IR. This interaction was modeled on a demonstrated interaction between rat IRS-1 and human IR. | BIND | 10026153 |
| INSR | CD220 | HHF5 | insulin receptor | Insulin Receptor Substrate-1 Binds to the Insulin Receptor. This interaction is modeled on demonstrated interaction between human IR and rat IRS-1 | BIND | 8626379 |
| INSR | CD220 | HHF5 | insulin receptor | - | HPRD,BioGRID | 11606564 |
| JAK1 | JAK1A | JAK1B | JTK3 | Janus kinase 1 (a protein tyrosine kinase) | Affinity Capture-Western Biochemical Activity | BioGRID | 7499365 |9492017 |
| JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | Affinity Capture-Western Biochemical Activity | BioGRID | 9492017 |11208867 |
| JAK3 | JAK-3 | JAK3_HUMAN | JAKL | L-JAK | LJAK | Janus kinase 3 (a protein tyrosine kinase, leukocyte) | - | HPRD,BioGRID | 7499365 |
| KHDRBS1 | FLJ34027 | Sam68 | p62 | KH domain containing, RNA binding, signal transduction associated 1 | Affinity Capture-Western | BioGRID | 11604231 |
| MAPK8 | JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1 | mitogen-activated protein kinase 8 | - | HPRD,BioGRID | 10722755 |11606564 |12417588 |
| MAPK9 | JNK-55 | JNK2 | JNK2A | JNK2ALPHA | JNK2B | JNK2BETA | PRKM9 | SAPK | p54a | p54aSAPK | mitogen-activated protein kinase 9 | - | HPRD | 12417588 |
| NISCH | FLJ14425 | FLJ40413 | FLJ90519 | I-1 | IRAS | KIAA0975 | nischarin | Affinity Capture-Western | BioGRID | 11912194 |
| PHIP | FLJ20705 | FLJ45918 | MGC90216 | WDR11 | ndrp | pleckstrin homology domain interacting protein | - | HPRD | 11018022 |
| PIK3CA | MGC142161 | MGC142163 | PI3K | p110-alpha | phosphoinositide-3-kinase, catalytic, alpha polypeptide | Affinity Capture-Western | BioGRID | 16354680 |
| PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | Affinity Capture-Western Far Western | BioGRID | 1381348 |12107746 |12173038 |12730242 |
| PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD | 1381348 |12173038 |
| PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD | 12220227 |
| PIK3R2 | P85B | p85 | p85-BETA | phosphoinositide-3-kinase, regulatory subunit 2 (beta) | IRS-1 interacts with p85-beta. This interaction was modeled based on a demonstrated interaction between IRS-1 from an unspecified species and p85-beta from an unknown species. | BIND | 11172806 |
| PIK3R2 | P85B | p85 | p85-BETA | phosphoinositide-3-kinase, regulatory subunit 2 (beta) | - | HPRD | 11120660 |
| PIK3R3 | DKFZp686P05226 | FLJ41892 | p55 | p55-GAMMA | phosphoinositide-3-kinase, regulatory subunit 3 (gamma) | - | HPRD,BioGRID | 7542745 |9415396 |10417350 |
| PRKCD | MAY1 | MGC49908 | PKCD | nPKC-delta | protein kinase C, delta | - | HPRD,BioGRID | 12031982 |
| PTK2 | FADK | FAK | FAK1 | pp125FAK | PTK2 protein tyrosine kinase 2 | - | HPRD,BioGRID | 9822703 |
| PTPN1 | PTP1B | protein tyrosine phosphatase, non-receptor type 1 | - | HPRD,BioGRID | 10660596 |
| PTPN11 | BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 | protein tyrosine phosphatase, non-receptor type 11 | - | HPRD,BioGRID | 8505282 |9756938 |
| PTPRC | B220 | CD45 | CD45R | GP180 | LCA | LY5 | T200 | protein tyrosine phosphatase, receptor type, C | - | HPRD,BioGRID | 8557683 |
| PTPRF | FLJ43335 | FLJ45062 | FLJ45567 | LAR | protein tyrosine phosphatase, receptor type, F | - | HPRD | 10660596 |
| SFN | YWHAS | stratifin | Affinity Capture-MS | BioGRID | 15778465 |
| SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | Direct interaction between IRS-1 and SHC. This interaction was modeled on a demonstrated interaction between rat IRS-1 and human SHC | BIND | 9202037 |
| SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | - | HPRD,BioGRID | 7499194 |
| SOCS1 | CIS1 | CISH1 | JAB | SOCS-1 | SSI-1 | SSI1 | TIP3 | suppressor of cytokine signaling 1 | - | HPRD,BioGRID | 11208867 |12228220 |
| SOCS3 | ATOD4 | CIS3 | Cish3 | MGC71791 | SOCS-3 | SSI-3 | SSI3 | suppressor of cytokine signaling 3 | - | HPRD | 12228220 |
| TUB | rd5 | tubby homolog (mouse) | - | HPRD | 10455176 |
| TYK2 | JTK1 | tyrosine kinase 2 | - | HPRD,BioGRID | 8550573 |
| UBTF | NOR-90 | UBF | upstream binding transcription factor, RNA polymerase I | - | HPRD,BioGRID | 12554758 |
| YWHAB | GW128 | HS1 | KCIP-1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | - | HPRD,BioGRID | 9422753 |
| YWHAE | 14-3-3E | FLJ45465 | KCIP-1 | MDCR | MDS | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide | IRS-1 interacts with 14-3-3-epsilon isoform. This interaction was modeled on a demonstrated interaction between human IRS-1 and mouse 14-3-3-epsilon isoform. | BIND | 9111084 |
| YWHAE | 14-3-3E | FLJ45465 | KCIP-1 | MDCR | MDS | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide | - | HPRD,BioGRID | 9111084 |9312143 |
| YWHAH | YWHA1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide | Affinity Capture-Western | BioGRID | 11969417 |
| YWHAZ | KCIP-1 | MGC111427 | MGC126532 | MGC138156 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | - | HPRD,BioGRID | 9312143 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
| KEGG TYPE II DIABETES MELLITUS | 47 | 41 | All SZGR 2.0 genes in this pathway |
| KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION | 42 | 29 | All SZGR 2.0 genes in this pathway |
| BIOCARTA GH PATHWAY | 28 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA IGF1 PATHWAY | 21 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA IL4 PATHWAY | 11 | 8 | All SZGR 2.0 genes in this pathway |
| BIOCARTA IL2RB PATHWAY | 38 | 26 | All SZGR 2.0 genes in this pathway |
| BIOCARTA INSULIN PATHWAY | 22 | 16 | All SZGR 2.0 genes in this pathway |
| BIOCARTA IGF1R PATHWAY | 23 | 20 | All SZGR 2.0 genes in this pathway |
| BIOCARTA EIF4 PATHWAY | 24 | 19 | All SZGR 2.0 genes in this pathway |
| SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
| SIG IL4RECEPTOR IN B LYPHOCYTES | 27 | 23 | All SZGR 2.0 genes in this pathway |
| SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES | 51 | 41 | All SZGR 2.0 genes in this pathway |
| PID INSULIN PATHWAY | 45 | 32 | All SZGR 2.0 genes in this pathway |
| PID IL4 2PATHWAY | 65 | 43 | All SZGR 2.0 genes in this pathway |
| PID PTP1B PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
| PID RET PATHWAY | 39 | 29 | All SZGR 2.0 genes in this pathway |
| PID SHP2 PATHWAY | 58 | 46 | All SZGR 2.0 genes in this pathway |
| PID MTOR 4PATHWAY | 69 | 55 | All SZGR 2.0 genes in this pathway |
| PID IL2 1PATHWAY | 55 | 43 | All SZGR 2.0 genes in this pathway |
| PID IGF1 PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
| PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P2 PATHWAY | 24 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
| REACTOME GROWTH HORMONE RECEPTOR SIGNALING | 24 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
| REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
| REACTOME PI3K AKT ACTIVATION | 38 | 29 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNAL ATTENUATION | 14 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME SOS MEDIATED SIGNALLING | 14 | 13 | All SZGR 2.0 genes in this pathway |
| REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
| REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
| REACTOME PI3K CASCADE | 71 | 51 | All SZGR 2.0 genes in this pathway |
| SAMOLS TARGETS OF KHSV MIRNAS DN | 62 | 35 | All SZGR 2.0 genes in this pathway |
| DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
| BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER | 22 | 19 | All SZGR 2.0 genes in this pathway |
| SCHEIDEREIT IKK TARGETS | 18 | 15 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
| SCHEIDEREIT IKK INTERACTING PROTEINS | 58 | 45 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| LEE TARGETS OF PTCH1 AND SUFU UP | 53 | 37 | All SZGR 2.0 genes in this pathway |
| BASSO CD40 SIGNALING DN | 68 | 44 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN | 50 | 32 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 10HR DN | 56 | 37 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
| DASU IL6 SIGNALING SCAR UP | 30 | 21 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN WITHOUT MGMT 48HR DN | 32 | 25 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
| GENTILE UV RESPONSE CLUSTER D8 | 40 | 29 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
| HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| MASSARWEH RESPONSE TO ESTRADIOL | 61 | 47 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
| JIANG TIP30 TARGETS UP | 46 | 28 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
| DING LUNG CANCER BY MUTATION RATE | 20 | 18 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
| PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| WINZEN DEGRADED VIA KHSRP | 100 | 70 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| IKEDA MIR30 TARGETS UP | 116 | 87 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE VIA P38 PARTIAL | 160 | 106 | All SZGR 2.0 genes in this pathway |
| ZHANG ADIPOGENESIS BY BMP7 | 14 | 12 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-126/126-3p | 131 | 137 | 1A | hsa-miR-126brain | UCGUACCGUGAGUAAUAAUGC |
| miR-128 | 232 | 239 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-145 | 4 | 10 | m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
| miR-183 | 671 | 678 | 1A,m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
| miR-200bc/429 | 449 | 455 | 1A | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-27 | 233 | 239 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-30-5p | 154 | 160 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-487b | 132 | 138 | m8 | hsa-miR-487b | AAUCGUACAGGGUCAUCCACUU |
| miR-96 | 209 | 215 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.