SZGR2

Summary ?

GeneID	472
Symbol	ATM
Synonyms	AT1\|ATA\|ATC\|ATD\|ATDC\|ATE\|TEL1\|TELO1
Description	ATM serine/threonine kinase
Reference	MIM:607585\|HGNC:HGNC:795\|Ensembl:ENSG00000149311\|HPRD:06347\|Vega:OTTHUMG00000166480
Gene type	protein-coding
Map location	11q22-q23
Pascal p-value	0.768
Sherlock p-value	0.543
Fetal beta	1.15
Support	INTRACELLULAR SIGNAL TRANSDUCTION Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.006
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0817

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ROBLD3	0.88	0.85
CCDC56	0.85	0.81
MRPL36	0.85	0.78
PRELID1	0.83	0.77
PSMB3	0.82	0.80
RNF181	0.82	0.83
MRPL20	0.81	0.73
GABARAP	0.81	0.77
PSMB6	0.81	0.84
RNF7	0.81	0.77

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-ATP8	-0.42	-0.46
AF347015.18	-0.40	-0.44
COBLL1	-0.40	-0.40
PTRF	-0.40	-0.42
MYH9	-0.39	-0.37
AF347015.26	-0.39	-0.43
EPAS1	-0.39	-0.41
GIMAP8	-0.38	-0.40
AF347015.2	-0.38	-0.40
FLT1	-0.37	-0.42

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0004674	protein serine/threonine kinase activity	IDA		11375976
GO:0016740	transferase activity	IEA		-
GO:0016303	1-phosphatidylinositol-3-kinase activity	IMP		11375976
GO:0047485	protein N-terminus binding	IDA		11375976
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	IEA	Brain (GO term level: 7)	-
GO:0051402	neuron apoptosis	IEA	neuron, axon, dendrite (GO term level: 7)	-
GO:0000077	DNA damage checkpoint	IEA		-
GO:0001756	somitogenesis	IEA		-
GO:0007131	reciprocal meiotic recombination	TAS		7792600
GO:0006468	protein amino acid phosphorylation	IEA		-
GO:0008219	cell death	IEA		-
GO:0007292	female gamete generation	IEA		-
GO:0006281	DNA repair	IEA		-
GO:0006281	DNA repair	TAS		9733515
GO:0007165	signal transduction	TAS		7792600
GO:0008630	DNA damage response, signal transduction resulting in induction of apoptosis	IEA		-
GO:0007094	mitotic cell cycle spindle assembly checkpoint	IMP		11943150
GO:0007507	heart development	IEA		-
GO:0010212	response to ionizing radiation	IDA		11375976
GO:0045786	negative regulation of cell cycle	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005819	spindle	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005654	nucleoplasm	EXP		10550055 \|10959836 \|11331603 \|12556884 \|12607003
GO:0031410	cytoplasmic vesicle	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD,BioGRID	9168117
AP1B1	ADTB1 \| AP105A \| BAM22 \| CLAPB2	adaptor-related protein complex 1, beta 1 subunit	Protein-peptide	BioGRID	10608806
AP2A2	ADTAB \| CLAPA2 \| HIP9 \| HYPJ	adaptor-related protein complex 2, alpha 2 subunit	Protein-peptide	BioGRID	10608806
AP2B1	ADTB2 \| AP105B \| AP2-BETA \| CLAPB1 \| DKFZp781K0743	adaptor-related protein complex 2, beta 1 subunit	-	HPRD	9707615
AP3B2	DKFZp686D17136 \| NAPTB	adaptor-related protein complex 3, beta 2 subunit	-	HPRD	9707615
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	An unspecified isoform of ATM interacts with and phosphorylates ATF2.	BIND	15916964
ATM	AT1 \| ATA \| ATC \| ATD \| ATDC \| ATE \| DKFZp781A0353 \| MGC74674 \| TEL1 \| TELO1	ataxia telangiectasia mutated	Protein-peptide	BioGRID	10608806
ATM	AT1 \| ATA \| ATC \| ATD \| ATDC \| ATE \| DKFZp781A0353 \| MGC74674 \| TEL1 \| TELO1	ataxia telangiectasia mutated	ATM interacts with itself to form a dimer.	BIND	15790808
ATR	FRP1 \| MEC1 \| SCKL \| SCKL1	ataxia telangiectasia and Rad3 related	Protein-peptide	BioGRID	10608806
BLM	BS \| MGC126616 \| MGC131618 \| MGC131620 \| RECQ2 \| RECQL2 \| RECQL3	Bloom syndrome	Affinity Capture-Western Co-purification Reconstituted Complex	BioGRID	10783165 \|12034743
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Affinity Capture-Western Co-purification Protein-peptide Reconstituted Complex	BioGRID	10550055 \|10608806 \|10783165 \|10866324 \|11016625 \|11114888 \|11278964
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD	2001833
BRCA2	BRCC2 \| FACD \| FAD \| FAD1 \| FANCB \| FANCD \| FANCD1	breast cancer 2, early onset	Reconstituted Complex	BioGRID	15199141
CAT	MGC138422 \| MGC138424	catalase	-	HPRD	10567403
CHEK1	CHK1	CHK1 checkpoint homolog (S. pombe)	Protein-peptide	BioGRID	10608806
CHEK2	CDS1 \| CHK2 \| HuCds1 \| LFS2 \| PP1425 \| RAD53	CHK2 checkpoint homolog (S. pombe)	ATM phosphorylates Chk2 at threonine 68.	BIND	15790808
CHEK2	CDS1 \| CHK2 \| HuCds1 \| LFS2 \| PP1425 \| RAD53	CHK2 checkpoint homolog (S. pombe)	ATM phosphorylates Chk2 at threonine 68.	BIND	15064416
CREB1	CREB \| MGC9284	cAMP responsive element binding protein 1	Affinity Capture-Western	BioGRID	15073328
E4F1	E4F \| MGC99614	E4F transcription factor 1	Protein-peptide	BioGRID	10608806
EEF1E1	AIMP3 \| P18	eukaryotic translation elongation factor 1 epsilon 1	p18 interacts with ATM.	BIND	15680327
EIF4EBP1	4E-BP1 \| 4EBP1 \| BP-1 \| MGC4316 \| PHAS-I	eukaryotic translation initiation factor 4E binding protein 1	Protein-peptide	BioGRID	10608806
FANCD2	DKFZp762A223 \| FA-D2 \| FA4 \| FACD \| FAD \| FAD2 \| FANCD \| FLJ23826	Fanconi anemia, complementation group D2	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12086603 \|14499622
H2AFX	H2A.X \| H2A/X \| H2AX	H2A histone family, member X	ATM phosphorylates the carboxy terminus of H2AX.	BIND	15064416
HINT1	FLJ30414 \| FLJ32340 \| HINT \| PKCI-1 \| PRKCNH1	histidine triad nucleotide binding protein 1	-	HPRD	7644499
LIG4	-	ligase IV, DNA, ATP-dependent	Protein-peptide	BioGRID	10608806
MCM2	BM28 \| CCNL1 \| CDCL1 \| D3S3194 \| KIAA0030 \| MGC10606 \| MITOTIN \| cdc19	minichromosome maintenance complex component 2	Biochemical Activity	BioGRID	15210935
MDC1	DKFZp781A0122 \| KIAA0170 \| MGC166888 \| NFBD1	mediator of DNA damage checkpoint 1	-	HPRD	12607005
MDC1	DKFZp781A0122 \| KIAA0170 \| MGC166888 \| NFBD1	mediator of DNA damage checkpoint 1	Affinity Capture-Western	BioGRID	14519663
MLH1	COCA2 \| FCC2 \| HNPCC \| HNPCC2 \| MGC5172 \| hMLH1	mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)	Co-purification	BioGRID	10783165
MRE11A	ATLD \| HNGS1 \| MRE11 \| MRE11B	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	ATM interacts with MRE11A (Mre11).	BIND	15758953
MRE11A	ATLD \| HNGS1 \| MRE11 \| MRE11B	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	Co-purification Protein-peptide	BioGRID	10608806 \|10783165
MSH2	COCA1 \| FCC1 \| HNPCC \| HNPCC1 \| LCFS2	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)	Co-purification	BioGRID	10783165
MSH6	GTBP \| HNPCC5 \| HSAP	mutS homolog 6 (E. coli)	Co-purification	BioGRID	10783165
NBN	AT-V1 \| AT-V2 \| ATV \| FLJ10155 \| MGC87362 \| NBS \| NBS1 \| P95	nibrin	Co-purification Protein-peptide	BioGRID	10608806 \|10783165
NBN	AT-V1 \| AT-V2 \| ATV \| FLJ10155 \| MGC87362 \| NBS \| NBS1 \| P95	nibrin	NBS1 interacts with ATM.	BIND	15758953
PEX5	FLJ50634 \| FLJ50721 \| FLJ51948 \| PTS1-BP \| PTS1R \| PXR1	peroxisomal biogenesis factor 5	-	HPRD,BioGRID	10567403
PRKDC	DNA-PKcs \| DNAPK \| DNPK1 \| HYRC \| HYRC1 \| XRCC7 \| p350	protein kinase, DNA-activated, catalytic polypeptide	-	HPRD,BioGRID	10464290
PTS	FLJ97081 \| PTPS	6-pyruvoyltetrahydropterin synthase	Protein-peptide	BioGRID	10608806
RAD17	CCYC \| FLJ41520 \| HRAD17 \| R24L \| RAD17SP \| RAD24	RAD17 homolog (S. pombe)	-	HPRD,BioGRID	11418864
RAD50	RAD50-2 \| hRad50	RAD50 homolog (S. cerevisiae)	Co-purification	BioGRID	10783165
RAD51	BRCC5 \| HRAD51 \| HsRad51 \| HsT16930 \| RAD51A \| RECA	RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)	Affinity Capture-Western	BioGRID	10212258
RBBP8	CTIP \| RIM	retinoblastoma binding protein 8	Affinity Capture-Western Protein-peptide Reconstituted Complex	BioGRID	10608806 \|10910365
RFC1	A1 \| MGC51786 \| MHCBFB \| PO-GA \| RECC1 \| RFC \| RFC140	replication factor C (activator 1) 1, 145kDa	Co-purification	BioGRID	10783165
RHEB	MGC111559 \| RHEB2	Ras homolog enriched in brain	Affinity Capture-Western Reconstituted Complex	BioGRID	15854902
RHEB	MGC111559 \| RHEB2	Ras homolog enriched in brain	ATM interacts with Rheb.	BIND	15854902
SMC1A	CDLS2 \| DKFZp686L19178 \| DXS423E \| KIAA0178 \| MGC138332 \| SB1.8 \| SMC1 \| SMC1L1 \| SMC1alpha \| SMCB	structural maintenance of chromosomes 1A	Affinity Capture-Western Reconstituted Complex	BioGRID	11877376
TERF1	FLJ41416 \| PIN2 \| TRBF1 \| TRF \| TRF1 \| hTRF1-AS \| t-TRF1	telomeric repeat binding factor (NIMA-interacting) 1	-	HPRD,BioGRID	11375976
TIPARP	DDF1 \| DKFZp434J214 \| DKFZp686N0351 \| DKFZp686P1838 \| FLJ40466 \| PARP-1 \| PARP-7 \| PARP7	TCDD-inducible poly(ADP-ribose) polymerase	-	HPRD	11238919
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	9843217
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	ATM phosphorylates p53 at serine 15.	BIND	15064416
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	An unspecified isoform of ATM interacts with and phosphorylates p53. This interaction was modeled on a demonstrated interaction between human ATM and p53 from an unspecified species.	BIND	15916964
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	ATM phosphorylates p53 at Ser15.	BIND	15175154
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	ATM phosphorylates p53 at serine 15.	BIND	15790808
TP53BP1	53BP1 \| FLJ41424 \| MGC138366 \| p202	tumor protein p53 binding protein 1	Biochemical Activity Reconstituted Complex	BioGRID	12447390 \|12697768
UPF1	FLJ43809 \| FLJ46894 \| HUPF1 \| KIAA0221 \| NORF1 \| RENT1 \| pNORF1	UPF1 regulator of nonsense transcripts homolog (yeast)	ATM phosphorylates hUpf1.	BIND	15175154
WRN	DKFZp686C2056 \| RECQ3 \| RECQL2 \| RECQL3	Werner syndrome	Protein-peptide	BioGRID	10608806
XRCC5	FLJ39089 \| KARP-1 \| KARP1 \| KU80 \| KUB2 \| Ku86 \| NFIV	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	XRCC5 (Ku80) interacts with ATM.	BIND	15758953

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG P53 SIGNALING PATHWAY	69	45	All SZGR 2.0 genes in this pathway
KEGG APOPTOSIS	88	62	All SZGR 2.0 genes in this pathway
BIOCARTA CHEMICAL PATHWAY	22	15	All SZGR 2.0 genes in this pathway
BIOCARTA ATM PATHWAY	20	16	All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY	28	21	All SZGR 2.0 genes in this pathway
BIOCARTA G2 PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA P53HYPOXIA PATHWAY	23	21	All SZGR 2.0 genes in this pathway
BIOCARTA P53 PATHWAY	16	13	All SZGR 2.0 genes in this pathway
BIOCARTA RB PATHWAY	13	11	All SZGR 2.0 genes in this pathway
BIOCARTA ATRBRCA PATHWAY	21	12	All SZGR 2.0 genes in this pathway
PID FANCONI PATHWAY	47	28	All SZGR 2.0 genes in this pathway
PID P38 MKK3 6PATHWAY	26	21	All SZGR 2.0 genes in this pathway
PID NFKAPPAB CANONICAL PATHWAY	23	20	All SZGR 2.0 genes in this pathway
PID E2F PATHWAY	74	48	All SZGR 2.0 genes in this pathway
PID ATM PATHWAY	34	25	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
PID DELTA NP63 PATHWAY	47	34	All SZGR 2.0 genes in this pathway
PID BARD1 PATHWAY	29	19	All SZGR 2.0 genes in this pathway
PID P53 REGULATION PATHWAY	59	50	All SZGR 2.0 genes in this pathway
REACTOME MEIOSIS	116	81	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME P53 INDEPENDENT G1 S DNA DAMAGE CHECKPOINT	51	31	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE CHECKPOINTS	124	70	All SZGR 2.0 genes in this pathway
REACTOME HOMOLOGOUS RECOMBINATION REPAIR OF REPLICATION INDEPENDENT DOUBLE STRAND BREAKS	17	11	All SZGR 2.0 genes in this pathway
REACTOME P53 DEPENDENT G1 DNA DAMAGE RESPONSE	57	35	All SZGR 2.0 genes in this pathway
REACTOME FANCONI ANEMIA PATHWAY	25	11	All SZGR 2.0 genes in this pathway
REACTOME DOUBLE STRAND BREAK REPAIR	24	14	All SZGR 2.0 genes in this pathway
REACTOME AUTODEGRADATION OF THE E3 UBIQUITIN LIGASE COP1	51	30	All SZGR 2.0 genes in this pathway
REACTOME DNA REPAIR	112	59	All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC RECOMBINATION	86	62	All SZGR 2.0 genes in this pathway
REACTOME G2 M CHECKPOINTS	45	23	All SZGR 2.0 genes in this pathway
REACTOME G2 M DNA DAMAGE CHECKPOINT	12	8	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA DN	52	30	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA DN	70	38	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
WIKMAN ASBESTOS LUNG CANCER DN	28	13	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR DN	64	39	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR DN	75	50	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP DN	35	20	All SZGR 2.0 genes in this pathway
RAMJAUN APOPTOSIS BY TGFB1 VIA SMAD4 DN	8	6	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 23	24	13	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK INTERACTING PROTEINS	58	45	All SZGR 2.0 genes in this pathway
SCHRAMM INHBA TARGETS DN	24	12	All SZGR 2.0 genes in this pathway
CALVET IRINOTECAN SENSITIVE VS RESISTANT UP	5	5	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK	117	72	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES	230	137	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY	26	22	All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN	160	110	All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO HD MTX UP	23	13	All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 11Q23 DELETION	23	18	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING DN	36	24	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
GALI TP53 TARGETS APOPTOTIC UP	8	7	All SZGR 2.0 genes in this pathway
MATZUK MEIOTIC AND DNA REPAIR	39	26	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE	72	55	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
LEE EARLY T LYMPHOCYTE DN	57	36	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS DN	89	50	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2	356	214	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S2	115	74	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP	430	288	All SZGR 2.0 genes in this pathway
KRIEG KDM3A TARGETS NOT HYPOXIA	208	107	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-203.1	2297	2303	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ATM