Gene Page: PPP3CC
Summary ?
GeneID | 5533 |
Symbol | PPP3CC |
Synonyms | CALNA3|CNA3|PP2Bgamma |
Description | protein phosphatase 3 catalytic subunit gamma |
Reference | MIM:114107|HGNC:HGNC:9316|Ensembl:ENSG00000120910|HPRD:00236|Vega:OTTHUMG00000163802 |
Gene type | protein-coding |
Map location | 8p21.3 |
Pascal p-value | 9.137E-4 |
Sherlock p-value | 0.91 |
Fetal beta | 0.292 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Nucleus accumbens basal ganglia Meta |
Support | INTRACELLULAR SIGNAL TRANSDUCTION |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 31 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg01320780 | 8 | 22298453 | PPP3CC | 4.88E-6 | -0.326 | 0.01 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KBTBD6 | 0.93 | 0.93 |
PANX1 | 0.92 | 0.95 |
REEP1 | 0.91 | 0.93 |
CTTNBP2NL | 0.91 | 0.95 |
KCTD10 | 0.91 | 0.93 |
PDIK1L | 0.91 | 0.95 |
HSDL1 | 0.91 | 0.94 |
HMGCR | 0.90 | 0.93 |
B4GALT5 | 0.90 | 0.95 |
DAAM1 | 0.90 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AIFM3 | -0.68 | -0.76 |
AF347015.31 | -0.67 | -0.87 |
C5orf53 | -0.67 | -0.74 |
HLA-F | -0.66 | -0.73 |
MT-CO2 | -0.66 | -0.87 |
HSD17B14 | -0.66 | -0.79 |
AF347015.27 | -0.66 | -0.84 |
TSC22D4 | -0.66 | -0.76 |
S100B | -0.65 | -0.79 |
FXYD1 | -0.65 | -0.84 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005506 | iron ion binding | IEA | - | |
GO:0005516 | calmodulin binding | IEA | - | |
GO:0004721 | phosphoprotein phosphatase activity | IEA | - | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008633 | activation of pro-apoptotic gene products | EXP | 15231831 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 10195903 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG OOCYTE MEIOSIS | 114 | 79 | All SZGR 2.0 genes in this pathway |
KEGG APOPTOSIS | 88 | 62 | All SZGR 2.0 genes in this pathway |
KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG VEGF SIGNALING PATHWAY | 76 | 53 | All SZGR 2.0 genes in this pathway |
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY | 137 | 92 | All SZGR 2.0 genes in this pathway |
KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
KEGG B CELL RECEPTOR SIGNALING PATHWAY | 75 | 56 | All SZGR 2.0 genes in this pathway |
KEGG LONG TERM POTENTIATION | 70 | 57 | All SZGR 2.0 genes in this pathway |
KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS | 53 | 43 | All SZGR 2.0 genes in this pathway |
BIOCARTA BCR PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
BIOCARTA HDAC PATHWAY | 32 | 25 | All SZGR 2.0 genes in this pathway |
BIOCARTA CALCINEURIN PATHWAY | 21 | 17 | All SZGR 2.0 genes in this pathway |
BIOCARTA NDKDYNAMIN PATHWAY | 21 | 15 | All SZGR 2.0 genes in this pathway |
BIOCARTA FCER1 PATHWAY | 41 | 30 | All SZGR 2.0 genes in this pathway |
BIOCARTA FMLP PATHWAY | 39 | 29 | All SZGR 2.0 genes in this pathway |
BIOCARTA VIP PATHWAY | 29 | 26 | All SZGR 2.0 genes in this pathway |
BIOCARTA NFAT PATHWAY | 56 | 45 | All SZGR 2.0 genes in this pathway |
BIOCARTA NOS1 PATHWAY | 24 | 21 | All SZGR 2.0 genes in this pathway |
BIOCARTA PGC1A PATHWAY | 26 | 20 | All SZGR 2.0 genes in this pathway |
BIOCARTA MEF2D PATHWAY | 23 | 16 | All SZGR 2.0 genes in this pathway |
BIOCARTA GPCR PATHWAY | 37 | 31 | All SZGR 2.0 genes in this pathway |
BIOCARTA TCR PATHWAY | 49 | 37 | All SZGR 2.0 genes in this pathway |
SIG BCR SIGNALING PATHWAY | 46 | 38 | All SZGR 2.0 genes in this pathway |
PID BCR 5PATHWAY | 65 | 50 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE UP | 485 | 293 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
GAL LEUKEMIC STEM CELL DN | 244 | 153 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP | 136 | 80 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP | 276 | 165 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 UP | 341 | 197 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES CD4 DN | 116 | 71 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
XU HGF TARGETS REPRESSED BY AKT1 DN | 95 | 58 | All SZGR 2.0 genes in this pathway |
AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY UP | 86 | 48 | All SZGR 2.0 genes in this pathway |
KIM GASTRIC CANCER CHEMOSENSITIVITY | 103 | 64 | All SZGR 2.0 genes in this pathway |
LEE AGING MUSCLE DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN DN | 51 | 32 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE UP | 156 | 92 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-382 | 88 | 94 | m8 | hsa-miR-382brain | GAAGUUGUUCGUGGUGGAUUCG |
miR-500 | 103 | 109 | m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.