Gene Page: RELN
Summary ?
GeneID | 5649 |
Symbol | RELN |
Synonyms | ETL7|LIS2|PRO1598|RL |
Description | reelin |
Reference | MIM:600514|HGNC:HGNC:9957|Ensembl:ENSG00000189056|HPRD:02742|Vega:OTTHUMG00000157247 |
Gene type | protein-coding |
Map location | 7q22 |
Pascal p-value | 0.039 |
Sherlock p-value | 0.426 |
TADA p-value | 0.033 |
Fetal beta | 0.052 |
eGene | Myers' cis & trans |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 31 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
RELN | chr7 | 103194134 | T | C | NM_005045 NM_173054 | p.1981Y>C p.1981Y>C | missense missense | Schizophrenia | DNM:Fromer_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2502827 | chr1 | 176044216 | RELN | 5649 | 0.14 | trans | ||
rs3845734 | chr2 | 171125572 | RELN | 5649 | 0.12 | trans | ||
rs7584986 | chr2 | 184111432 | RELN | 5649 | 5.384E-5 | trans | ||
rs1368303 | chr5 | 147672388 | RELN | 5649 | 0.09 | trans | ||
snp_a-2055204 | 0 | RELN | 5649 | 0.2 | trans | |||
rs17104720 | chr14 | 77127308 | RELN | 5649 | 0.04 | trans | ||
rs16955618 | chr15 | 29937543 | RELN | 5649 | 6.42E-7 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AL161668.2 | 0.84 | 0.85 |
ERBB2 | 0.84 | 0.84 |
GNA12 | 0.84 | 0.84 |
ARAF | 0.82 | 0.79 |
HEATR2 | 0.81 | 0.77 |
SMO | 0.81 | 0.77 |
ASAP3 | 0.81 | 0.76 |
ZNF687 | 0.80 | 0.74 |
CHST14 | 0.80 | 0.79 |
PAK4 | 0.80 | 0.77 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.40 | -0.46 |
C5orf53 | -0.39 | -0.37 |
SYCP3 | -0.37 | -0.40 |
LY96 | -0.37 | -0.45 |
CLEC2B | -0.36 | -0.42 |
SPHAR | -0.36 | -0.47 |
RERGL | -0.36 | -0.42 |
GPR160 | -0.36 | -0.39 |
KMO | -0.35 | -0.36 |
AF347015.27 | -0.35 | -0.36 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005578 | proteinaceous extracellular matrix | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG ECM RECEPTOR INTERACTION | 84 | 53 | All SZGR 2.0 genes in this pathway |
PID REELIN PATHWAY | 29 | 29 | All SZGR 2.0 genes in this pathway |
PID LIS1 PATHWAY | 28 | 22 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP | 136 | 80 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER DN | 232 | 154 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
WANG BARRETTS ESOPHAGUS AND ESOPHAGUS CANCER DN | 37 | 22 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA PROGRESSION RISK | 74 | 44 | All SZGR 2.0 genes in this pathway |
ROVERSI GLIOMA COPY NUMBER UP | 100 | 75 | All SZGR 2.0 genes in this pathway |
KANG GIST WITH PDGFRA UP | 50 | 27 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
WATTEL AUTONOMOUS THYROID ADENOMA DN | 55 | 29 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
MORI SMALL PRE BII LYMPHOCYTE UP | 86 | 57 | All SZGR 2.0 genes in this pathway |
CHESLER BRAIN D6MIT150 QTL TRANS | 9 | 7 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS DN | 74 | 55 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS DN | 142 | 94 | All SZGR 2.0 genes in this pathway |
WANG LSD1 TARGETS UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C CLUSTER UP | 38 | 26 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE D7 DN | 40 | 22 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE 35D DN | 49 | 34 | All SZGR 2.0 genes in this pathway |
VANASSE BCL2 TARGETS UP | 40 | 25 | All SZGR 2.0 genes in this pathway |
HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE DN | 72 | 47 | All SZGR 2.0 genes in this pathway |
HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE DN | 50 | 33 | All SZGR 2.0 genes in this pathway |
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 DN | 69 | 38 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2 | 86 | 50 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 5 | 30 | 22 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
CHANGOLKAR H2AFY TARGETS DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
FOSTER KDM1A TARGETS UP | 266 | 142 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
NABA ECM GLYCOPROTEINS | 196 | 99 | All SZGR 2.0 genes in this pathway |
NABA CORE MATRISOME | 275 | 148 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 156 | 163 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-138 | 902 | 909 | 1A,m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-15/16/195/424/497 | 507 | 513 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-205 | 96 | 102 | 1A | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
miR-218 | 301 | 308 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-27 | 157 | 164 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-34/449 | 778 | 784 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-378 | 82 | 88 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-544 | 536 | 543 | 1A,m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.