Gene Page: TRIB3
Summary ?
GeneID | 57761 |
Symbol | TRIB3 |
Synonyms | C20orf97|NIPK|SINK|SKIP3|TRB3 |
Description | tribbles pseudokinase 3 |
Reference | MIM:607898|HGNC:HGNC:16228|Ensembl:ENSG00000101255|HPRD:09836|Vega:OTTHUMG00000031627 |
Gene type | protein-coding |
Map location | 20p13-p12.2 |
Pascal p-value | 0.457 |
Sherlock p-value | 0.113 |
Fetal beta | -0.153 |
eGene | Caudate basal ganglia Cortex Nucleus accumbens basal ganglia Myers' cis & trans Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0156 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs11164597 | chr1 | 103238443 | TRIB3 | 57761 | 0.08 | trans | ||
rs2276020 | chr11 | 67257555 | TRIB3 | 57761 | 0.08 | trans | ||
rs17202303 | chr16 | 63131959 | TRIB3 | 57761 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003714 | transcription corepressor activity | ISS | - | |
GO:0005515 | protein binding | IPI | 12743605 | |
GO:0005515 | protein binding | ISS | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004860 | protein kinase inhibitor activity | IEA | - | |
GO:0004672 | protein kinase activity | IEA | - | |
GO:0019901 | protein kinase binding | IPI | 15299019 | |
GO:0019901 | protein kinase binding | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0006469 | negative regulation of protein kinase activity | ISS | - | |
GO:0006950 | response to stress | IEA | - | |
GO:0006915 | apoptosis | IEA | - | |
GO:0043405 | regulation of MAP kinase activity | IDA | 15299019 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | ISS | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 12791994 |
ATF4 | CREB-2 | CREB2 | TAXREB67 | TXREB | activating transcription factor 4 (tax-responsive enhancer element B67) | - | HPRD,BioGRID | 12743605 |
ATF4 | CREB-2 | CREB2 | TAXREB67 | TXREB | activating transcription factor 4 (tax-responsive enhancer element B67) | SKIP3 interacts with ATF4. | BIND | 12743605 |
C7orf64 | DKFZP564O0523 | DKFZp686D1651 | HSPC304 | chromosome 7 open reading frame 64 | Two-hybrid | BioGRID | 16169070 |
COPS6 | CSN6 | MOV34-34KD | COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) | Two-hybrid | BioGRID | 16169070 |
DDIT3 | CEBPZ | CHOP | CHOP10 | GADD153 | MGC4154 | DNA-damage-inducible transcript 3 | TRIB3 (TRB3) interacts with DDIT3 (CHOP). | BIND | 15775988 |
EEF1G | EF1G | GIG35 | eukaryotic translation elongation factor 1 gamma | Two-hybrid | BioGRID | 16169070 |
GDF9 | - | growth differentiation factor 9 | Two-hybrid | BioGRID | 16169070 |
GIT1 | - | G protein-coupled receptor kinase interacting ArfGAP 1 | Two-hybrid | BioGRID | 16169070 |
KAT5 | ESA1 | HTATIP | HTATIP1 | PLIP | TIP | TIP60 | cPLA2 | K(lysine) acetyltransferase 5 | Two-hybrid | BioGRID | 16169070 |
RELA | MGC131774 | NFKB3 | p65 | v-rel reticuloendotheliosis viral oncogene homolog A (avian) | Affinity Capture-Western | BioGRID | 12736262 |
SETDB1 | ESET | KG1T | KIAA0067 | KMT1E | SET domain, bifurcated 1 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY SCF KIT | 78 | 59 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K EVENTS IN ERBB4 SIGNALING | 38 | 28 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K EVENTS IN ERBB2 SIGNALING | 44 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME PPARA ACTIVATES GENE EXPRESSION | 104 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING EVENTS OF B CELL RECEPTOR BCR | 97 | 66 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR | 126 | 90 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR IN DISEASE | 127 | 88 | All SZGR 2.0 genes in this pathway |
REACTOME NEGATIVE REGULATION OF THE PI3K AKT NETWORK | 9 | 5 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K AKT ACTIVATION | 38 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME GAB1 SIGNALOSOME | 38 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION | 95 | 76 | All SZGR 2.0 genes in this pathway |
REACTOME CD28 CO STIMULATION | 32 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME COSTIMULATION BY THE CD28 FAMILY | 63 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME CD28 DEPENDENT PI3K AKT SIGNALING | 22 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME PI 3K CASCADE | 56 | 39 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR | 100 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
REACTOME PIP3 ACTIVATES AKT SIGNALING | 29 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR | 112 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K CASCADE | 71 | 51 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
PRAMOONJAGO SOX4 TARGETS UP | 52 | 38 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
NOJIMA SFRP2 TARGETS UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLACK UP | 35 | 22 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP | 157 | 104 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 DN | 153 | 100 | All SZGR 2.0 genes in this pathway |
BERENJENO ROCK SIGNALING NOT VIA RHOA UP | 29 | 21 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS E DN | 22 | 12 | All SZGR 2.0 genes in this pathway |
KAN RESPONSE TO ARSENIC TRIOXIDE | 123 | 80 | All SZGR 2.0 genes in this pathway |
RAMJAUN APOPTOSIS BY TGFB1 VIA SMAD4 UP | 7 | 6 | All SZGR 2.0 genes in this pathway |
RAMJAUN APOPTOSIS BY TGFB1 VIA MAPK1 DN | 8 | 6 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
AIYAR COBRA1 TARGETS UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 MCF10A | 43 | 26 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 UP | 45 | 29 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 VS CD2 UP | 66 | 47 | All SZGR 2.0 genes in this pathway |
GERY CEBP TARGETS | 126 | 90 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS DN | 234 | 137 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
SARTIPY BLUNTED BY INSULIN RESISTANCE DN | 18 | 14 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS PEAK AT 0HR | 63 | 48 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS UP | 113 | 71 | All SZGR 2.0 genes in this pathway |
TSENG ADIPOGENIC POTENTIAL UP | 30 | 19 | All SZGR 2.0 genes in this pathway |
KRIGE AMINO ACID DEPRIVATION | 29 | 20 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION DN | 105 | 67 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
MARZEC IL2 SIGNALING UP | 115 | 80 | All SZGR 2.0 genes in this pathway |
OUYANG PROSTATE CANCER PROGRESSION DN | 21 | 16 | All SZGR 2.0 genes in this pathway |
HANN RESISTANCE TO BCL2 INHIBITOR DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
BHATI G2M ARREST BY 2METHOXYESTRADIOL DN | 127 | 75 | All SZGR 2.0 genes in this pathway |
PODAR RESPONSE TO ADAPHOSTIN UP | 147 | 98 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
WANG NEOPLASTIC TRANSFORMATION BY CCND1 MYC | 21 | 14 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
COULOUARN TEMPORAL TGFB1 SIGNATURE DN | 138 | 99 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS UP | 295 | 155 | All SZGR 2.0 genes in this pathway |
WANG ADIPOGENIC GENES REPRESSED BY SIRT1 | 28 | 21 | All SZGR 2.0 genes in this pathway |
LI DCP2 BOUND MRNA | 89 | 57 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS UP | 112 | 65 | All SZGR 2.0 genes in this pathway |
PARK OSTEOBLAST DIFFERENTIATION BY PHENYLAMIL UP | 13 | 11 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 94 | 100 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-182 | 464 | 470 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-96 | 463 | 470 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.