Gene Page: DPYSL4
Summary ?
GeneID | 10570 |
Symbol | DPYSL4 |
Synonyms | CRMP3|DRP-4|ULIP4 |
Description | dihydropyrimidinase like 4 |
Reference | MIM:608407|HGNC:HGNC:3016|Ensembl:ENSG00000151640|HPRD:07463|Vega:OTTHUMG00000019283 |
Gene type | protein-coding |
Map location | 10q26 |
Pascal p-value | 0.167 |
Sherlock p-value | 0.247 |
Fetal beta | 0.648 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum Cortex Myers' cis & trans Meta |
Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_clathrin G2Cdb.human_Synaptosome G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03487 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04064828 | 10 | 134002751 | DPYSL4 | 4.12E-4 | 0.672 | 0.044 | DMG:Wockner_2014 |
cg03304019 | 10 | 133998913 | DPYSL4 | 5.114E-4 | 0.42 | 0.047 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2035804 | chr10 | 134034378 | DPYSL4 | 10570 | 0.11 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
YWHAE | 0.93 | 0.91 |
HNRPLL | 0.92 | 0.92 |
C11orf58 | 0.92 | 0.89 |
ARF4 | 0.91 | 0.91 |
MRPL3 | 0.91 | 0.90 |
CNOT7 | 0.91 | 0.91 |
ABCE1 | 0.91 | 0.90 |
VPS26A | 0.91 | 0.90 |
TMED2 | 0.91 | 0.89 |
CUL2 | 0.91 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.74 | -0.76 |
AF347015.33 | -0.72 | -0.75 |
AF347015.8 | -0.72 | -0.76 |
MT-CYB | -0.71 | -0.74 |
AF347015.2 | -0.70 | -0.75 |
AF347015.31 | -0.70 | -0.74 |
AF347015.26 | -0.69 | -0.75 |
AF347015.15 | -0.69 | -0.75 |
FXYD1 | -0.69 | -0.76 |
AF347015.27 | -0.67 | -0.70 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016810 | hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9652388 |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME CRMPS IN SEMA3A SIGNALING | 14 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA BY DMOG UP | 130 | 85 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A TARGETS DN | 91 | 58 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A AND HIF2A TARGETS DN | 104 | 72 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 AND TP63 TARGETS | 205 | 145 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE UP | 299 | 167 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
TAVAZOIE METASTASIS | 108 | 68 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 3 UP | 170 | 97 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 6 UP | 140 | 81 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 535 | 541 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-34/449 | 214 | 221 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.