SZGR2

Summary ?

GeneID	1956
Symbol	EGFR
Synonyms	ERBB\|ERBB1\|HER1\|NISBD2\|PIG61\|mENA
Description	epidermal growth factor receptor
Reference	MIM:131550\|HGNC:HGNC:3236\|Ensembl:ENSG00000146648\|HPRD:00579\|Vega:OTTHUMG00000023661
Gene type	protein-coding
Map location	7p12
Pascal p-value	0.251
Fetal beta	-0.918
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 2.8135

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20706768	7	55225183	EGFR	4.973E-4	0.384	0.047	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NOTCH3	0.71	0.68
SYDE1	0.70	0.69
APLN	0.69	0.62
FGFR3	0.68	0.52
NFKB2	0.68	0.67
CASKIN2	0.68	0.65
AC020763.2	0.68	0.68
INPPL1	0.67	0.65
SLC2A1	0.67	0.65
PLXNB1	0.65	0.61

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TMEM70	-0.47	-0.48
THOC7	-0.47	-0.52
ZCCHC17	-0.44	-0.47
GLMN	-0.44	-0.48
AP4S1	-0.44	-0.48
C8orf38	-0.44	-0.46
BEX5	-0.44	-0.47
TCEAL7	-0.42	-0.49
C2orf80	-0.42	-0.44
MTIF3	-0.42	-0.48

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005006	epidermal growth factor receptor activity	IDA		12435727
GO:0005006	epidermal growth factor receptor activity	NAS		2790960 \|6325948
GO:0004888	transmembrane receptor activity	IDA		7736574
GO:0003690	double-stranded DNA binding	NAS		6325948
GO:0030235	nitric-oxide synthase regulator activity	IDA		12828935
GO:0004710	MAP/ERK kinase kinase activity	NAS		15542601
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0051015	actin filament binding	IDA		14702346
GO:0042802	identical protein binding	IPI		16777603
GO:0046982	protein heterodimerization activity	IDA		10572067
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001503	ossification	NAS		12925580
GO:0007202	activation of phospholipase C activity	TAS		12435727
GO:0007173	epidermal growth factor receptor signaling pathway	IDA		12435727
GO:0006950	response to stress	NAS		12828935
GO:0007166	cell surface receptor linked signal transduction	IDA		7736574
GO:0016337	cell-cell adhesion	IMP		12435727
GO:0042327	positive regulation of phosphorylation	IDA		15082764
GO:0050999	regulation of nitric-oxide synthase activity	IDA		12828935
GO:0051205	protein insertion into membrane	TAS		12435727
GO:0030335	positive regulation of cell migration	IMP		12435727
GO:0043406	positive regulation of MAP kinase activity	IDA		10572067
GO:0043006	calcium-dependent phospholipase A2 activation	TAS		12435727
GO:0050679	positive regulation of epithelial cell proliferation	IDA		10572067
GO:0050730	regulation of peptidyl-tyrosine phosphorylation	IMP		12435727
GO:0045786	negative regulation of cell cycle	IEA		-
GO:0046777	protein amino acid autophosphorylation	IEA		-
GO:0045429	positive regulation of nitric oxide biosynthetic process	IDA		12828935
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005615	extracellular space	NAS		9103388
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IDA		12828935
GO:0005737	cytoplasm	IDA		12435727
GO:0005768	endosome	IDA		14702346
GO:0005783	endoplasmic reticulum	IDA		18029348
GO:0030122	AP-2 adaptor complex	TAS		14702346
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	EXP		8493579 \|8639530 \|8845374 \|9356464 \|9544989 \|10567358 \|10648629 \|10734310 \|10913131 \|11823423 \|11894095 \|122181
GO:0005886	plasma membrane	IDA		15465819
GO:0016323	basolateral plasma membrane	IEA		-
GO:0030139	endocytic vesicle	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AMH	MIF \| MIS	anti-Mullerian hormone	-	HPRD	8596488
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Affinity Capture-Western Co-localization	BioGRID	15288768 \|15305378
AREG	AR \| CRDGF \| MGC13647 \| SDGF	amphiregulin	-	HPRD,BioGRID	10085134
ARF4	ARF2	ADP-ribosylation factor 4	-	HPRD,BioGRID	12446727
ATP5C1	ATP5C \| ATP5CL1	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	Two-hybrid	BioGRID	16169070
BTC	-	betacellulin	-	HPRD	9528863
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	EGFR interacts with calmodulin	BIND	14960328
CAMLG	CAML \| MGC163197	calcium modulating ligand	-	HPRD,BioGRID	12919676
CASP1	ICE \| IL1BC \| P45	caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)	-	HPRD,BioGRID	11226410
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	-	HPRD,BioGRID	9374534
CAV3	LGMD1C \| LQT9 \| MGC126100 \| MGC126101 \| MGC126129 \| VIP-21 \| VIP21	caveolin 3	-	HPRD,BioGRID	9374534
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	Affinity Capture-Western	BioGRID	10086340 \|12061819
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	-	HPRD	8662998
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	An unspecified isoform of EGFR interacts with CBL.	BIND	15735736
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	c-Cbl ubiquitinates an unspecified isoform of EGFR. This interaction was modeled on a demonstrated interaction between c-Cbl and EGFR, both from an unspecified species.	BIND	12234920
CBLB	DKFZp686J10223 \| DKFZp779A0729 \| DKFZp779F1443 \| FLJ36865 \| FLJ41152 \| Nbla00127 \| RNF56	Cas-Br-M (murine) ecotropic retroviral transforming sequence b	-	HPRD,BioGRID	10086340
CBLC	CBL-3 \| CBL-SL \| RNF57	Cas-Br-M (murine) ecotropic retroviral transforming sequence c	-	HPRD,BioGRID	10362357
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	An unspecified isoform of EGFR binds to Cyclin D1 promoter.	BIND	15950906
CD44	CDW44 \| CSPG8 \| ECMR-III \| HCELL \| IN \| LHR \| MC56 \| MDU2 \| MDU3 \| MGC10468 \| MIC4 \| MUTCH-I \| Pgp1	CD44 molecule (Indian blood group)	CD44 interacts with EGFR.	BIND	12093135
CD44	CDW44 \| CSPG8 \| ECMR-III \| HCELL \| IN \| LHR \| MC56 \| MDU2 \| MDU3 \| MGC10468 \| MIC4 \| MUTCH-I \| Pgp1	CD44 molecule (Indian blood group)	-	HPRD,BioGRID	12093135
CD82	4F9 \| C33 \| GR15 \| IA4 \| KAI1 \| R2 \| SAR2 \| ST6 \| TSPAN27	CD82 molecule	-	HPRD,BioGRID	10985391
CDC25A	CDC25A2	cell division cycle 25 homolog A (S. pombe)	-	HPRD,BioGRID	11912208
CDH1	Arc-1 \| CD324 \| CDHE \| ECAD \| LCAM \| UVO	cadherin 1, type 1, E-cadherin (epithelial)	EGFR interacts with E-cadherin	BIND	14681060
CDH1	Arc-1 \| CD324 \| CDHE \| ECAD \| LCAM \| UVO	cadherin 1, type 1, E-cadherin (epithelial)	-	HPRD,BioGRID	10969083
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	12095417
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	-	HPRD,BioGRID	9642287
CSK	MGC117393	c-src tyrosine kinase	Affinity Capture-MS	BioGRID	16729043
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD,BioGRID	9233779
CTNND1	CAS \| CTNND \| KIAA0384 \| P120CAS \| P120CTN \| p120	catenin (cadherin-associated protein), delta 1	Reconstituted Complex	BioGRID	9535896
DCN	CSCD \| DSPG2 \| PG40 \| PGII \| PGS2 \| SLRR1B	decorin	-	HPRD,BioGRID	9988678 \|12105206
DEGS1	DEGS \| DES1 \| Des-1 \| FADS7 \| MGC5079 \| MIG15 \| MLD	degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)	-	HPRD	9188692
DOK2	p56DOK \| p56dok-2	docking protein 2, 56kDa	-	HPRD,BioGRID	10508618
DUSP3	VHR	dual specificity phosphatase 3	Biochemical Activity	BioGRID	1281549
EGF	HOMG4 \| URG	epidermal growth factor (beta-urogastrone)	-	HPRD	10788520 \|12093292 \|12620237\|12093292
EGF	HOMG4 \| URG	epidermal growth factor (beta-urogastrone)	EGF interacts with EGFR.	BIND	15837620
EGF	HOMG4 \| URG	epidermal growth factor (beta-urogastrone)	-	HPRD,BioGRID	12093292
EGF	HOMG4 \| URG	epidermal growth factor (beta-urogastrone)	EGFR interacts with EGF. This interaction was modelled on a demonstrated interaction between EGFR from human and EGF from mouse.	BIND	8413296
EGF	HOMG4 \| URG	epidermal growth factor (beta-urogastrone)	An unspecified isoform of EGFR interacts with EGF.	BIND	15950906
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	EGFR interacts with EGFR.	BIND	15284455
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Affinity Capture-Western	BioGRID	14576349
EPPK1	EPIPL \| EPIPL1	epiplakin 1	-	HPRD	12577067
EPS15	AF-1P \| AF1P \| MLLT5	epidermal growth factor receptor pathway substrate 15	-	HPRD,BioGRID	9049247
EPS8	-	epidermal growth factor receptor pathway substrate 8	-	HPRD	7532293 \|12127568
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD	11500850
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	EGFR interacts with ErbB2.	BIND	15652750
ERBB3	ErbB-3 \| HER3 \| LCCS2 \| MDA-BF-1 \| MGC88033 \| c-erbB-3 \| c-erbB3 \| erbB3-S \| p180-ErbB3 \| p45-sErbB3 \| p85-sErbB3	v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)	-	HPRD,BioGRID	10527633
EREG	ER	epiregulin	-	HPRD,BioGRID	9419975
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	11887937
FER	TYK3	fer (fps/fes related) tyrosine kinase	-	HPRD,BioGRID	7623846
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	An unspecified isoform of EGFR binds to c-fos promoter.	BIND	15950906
GAB1	-	GRB2-associated binding protein 1	-	HPRD,BioGRID	11432805
GNAI2	GIP \| GNAI2B \| H_LUCA15.1 \| H_LUCA16.1	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	-	HPRD	11286993
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	Grb10 interacts with EGFR.	BIND	9506989
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	-	HPRD,BioGRID	9006901 \|9506989
GRB14	-	growth factor receptor-bound protein 14	-	HPRD,BioGRID	8647858
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	GRB2 interacts with an unspecified isoform of EGFR. This interaction was modeled on a demonstrated interaction between human GRB2, and rat EGFR.	BIND	15782189
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD	1322798 \|7527043
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	EGFR interacts with GRB2.	BIND	8305738
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Affinity Capture-MS Affinity Capture-Western Reconstituted Complex	BioGRID	1322798 \|7510700 \|7527043 \|8647858 \|9050991 \|10026169 \|10085134 \|11960376 \|12577067 \|16729043
GRB7	-	growth factor receptor-bound protein 7	-	HPRD	9710451
HBEGF	DTR \| DTS \| DTSF \| HEGFL	heparin-binding EGF-like growth factor	-	HPRD,BioGRID	12725245
HSP90AA1	FLJ31884 \| HSP86 \| HSP89A \| HSP90A \| HSP90N \| HSPC1 \| HSPCA \| HSPCAL1 \| HSPCAL4 \| HSPN \| Hsp89 \| Hsp90 \| LAP2	heat shock protein 90kDa alpha (cytosolic), class A member 1	EGFR interacts with Hsp90. This interaction was modeled on a demonstrated interaction between EGFR from an unspecified species and human Hsp90.	BIND	12471035
HTT	HD \| IT15	huntingtin	-	HPRD,BioGRID	9079622
IGF1R	CD221 \| IGFIR \| JTK13 \| MGC142170 \| MGC142172 \| MGC18216	insulin-like growth factor 1 receptor	Affinity Capture-Western	BioGRID	17047074
INPPL1	SHIP2	inositol polyphosphate phosphatase-like 1	-	HPRD,BioGRID	11349134
ITGA5	CD49e \| FNRA \| VLA5A	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	-	HPRD	10888683
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	Affinity Capture-Western	BioGRID	10358079
JUP	ARVD12 \| CTNNG \| DP3 \| DPIII \| PDGB \| PKGB	junction plakoglobin	Reconstituted Complex	BioGRID	9535896
KRT17	K17 \| PC \| PC2 \| PCHC1	keratin 17	-	HPRD	12577067
KRT18	CYK18 \| K18	keratin 18	-	HPRD	12577067
KRT7	CK7 \| K2C7 \| K7 \| MGC129731 \| MGC3625 \| SCL	keratin 7	-	HPRD	12577067
KRT8	CARD2 \| CK8 \| CYK8 \| K2C8 \| K8 \| KO	keratin 8	-	HPRD	12577067
LRSAM1	FLJ31641 \| RIFLE \| TAL	leucine rich repeat and sterile alpha motif containing 1	Affinity Capture-Western	BioGRID	15256501
MAP3K14	FTDCR1B \| HS \| HSNIK \| NIK	mitogen-activated protein kinase kinase kinase 14	-	HPRD,BioGRID	11116146
MAP4K1	HPK1	mitogen-activated protein kinase kinase kinase kinase 1	-	HPRD,BioGRID	9346925
MAPK14	CSBP1 \| CSBP2 \| CSPB1 \| EXIP \| Mxi2 \| PRKM14 \| PRKM15 \| RK \| SAPK2A \| p38 \| p38ALPHA	mitogen-activated protein kinase 14	Biochemical Activity	BioGRID	7535770
MUC1	CD227 \| EMA \| H23AG \| MAM6 \| PEM \| PEMT \| PUM	mucin 1, cell surface associated	-	HPRD,BioGRID	11278868 \|11483589
MUC1	CD227 \| EMA \| H23AG \| MAM6 \| PEM \| PEMT \| PUM	mucin 1, cell surface associated	MUC1 interacts with and is tyrosine-phosphorylated by EGFR.	BIND	11483589
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD,BioGRID	9362449
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	Affinity Capture-Western Reconstituted Complex	BioGRID	9737977 \|10026169
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	-	HPRD	1333047 \|9737977
NRG1	ARIA \| GGF \| GGF2 \| HGL \| HRG \| HRG1 \| HRGA \| NDF \| SMDF	neuregulin 1	Affinity Capture-Western	BioGRID	7730382
NRG1	ARIA \| GGF \| GGF2 \| HGL \| HRG \| HRG1 \| HRGA \| NDF \| SMDF	neuregulin 1	-	HPRD	8702572
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	Tyrosine-phosphorylated EGFR interacts with PAK1.	BIND	12522133
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	-	HPRD,BioGRID	9506992
PIK3C2B	C2-PI3K \| DKFZp686G16234	phosphoinositide-3-kinase, class 2, beta polypeptide	-	HPRD,BioGRID	11533253
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD	8662998
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	EGFR interacts with p85. This interaction was modeled on a demonstrated interaction between human EGFR and bovine p85.	BIND	1372092
PIK3R2	P85B \| p85 \| p85-BETA	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	Tyrosine phosphorlyated EGFR interacts with p85-beta.	BIND	11172806
PITPNA	MGC99649 \| PITPN \| VIB1A	phosphatidylinositol transfer protein, alpha	-	HPRD,BioGRID	7761838
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD,BioGRID	9207933
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	EGFR interacts with PLC-gamma. This interaction was modelled on a demonstrated interaction between human EGFR and bovine PLC-gamma.	BIND	2173144 \|2176151
PLD2	-	phospholipase D2	-	HPRD,BioGRID	9837959
PLD2	-	phospholipase D2	EGFR interacts with PLD1. This interaction was modelled on a demonstrated interaction between human EGFR and mouse PLD2.	BIND	9837959
PLEC1	EBS1 \| EBSO \| HD1 \| PCN \| PLEC1b \| PLTN	plectin 1, intermediate filament binding protein 500kDa	-	HPRD	12577067
PLSCR1	MMTRA1B	phospholipid scramblase 1	-	HPRD,BioGRID	12009895
PLSCR1	MMTRA1B	phospholipid scramblase 1	-	HPRD	12009895 \|12871937
PRKACA	MGC102831 \| MGC48865 \| PKACA	protein kinase, cAMP-dependent, catalytic, alpha	-	HPRD,BioGRID	9050991
PRKAR1A	CAR \| CNC \| CNC1 \| DKFZp779L0468 \| MGC17251 \| PKR1 \| PPNAD1 \| PRKAR1 \| TSE1	protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)	-	HPRD,BioGRID	9050991
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	-	HPRD,BioGRID	12878187
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD,BioGRID	10806474
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	10777553
PTK6	BRK \| FLJ42088	PTK6 protein tyrosine kinase 6	-	HPRD,BioGRID	8940083
PTPN1	PTP1B	protein tyrosine phosphatase, non-receptor type 1	-	HPRD,BioGRID	7540771 \|8621392 \|10889023 \|12573287
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	-	HPRD,BioGRID	7673163
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	-	HPRD,BioGRID	9733788
PTPRJ	CD148 \| DEP1 \| HPTPeta \| R-PTP-ETA \| SCC1	protein tyrosine phosphatase, receptor type, J	-	HPRD	9115287
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	Reconstituted Complex	BioGRID	8647858
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	GAP interacts with EGFR.	BIND	1385407 \|1850098 \|2176151
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD	1633149
RGS16	A28-RGS14 \| A28-RGS14P \| RGS-R	regulator of G-protein signaling 16	-	HPRD,BioGRID	11602604
RIPK1	FLJ39204 \| RIP \| RIP1	receptor (TNFRSF)-interacting serine-threonine kinase 1	-	HPRD,BioGRID	11116146
ROS1	MCF3 \| ROS \| c-ros-1	c-ros oncogene 1 , receptor tyrosine kinase	Affinity Capture-Western	BioGRID	11094073
SGSM2	KIAA0397 \| RUTBC1	small G protein signaling modulator 2	Two-hybrid	BioGRID	16169070
SH2D3A	NSP1	SH2 domain containing 3A	-	HPRD,BioGRID	10187783
SH3BGRL	MGC117402 \| SH3BGR	SH3 domain binding glutamic acid-rich protein like	Affinity Capture-MS	BioGRID	16729043
SH3KBP1	CIN85 \| GIG10 \| MIG18	SH3-domain kinase binding protein 1	Affinity Capture-Western	BioGRID	11894095 \|12177062
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Shc interacts with activated EGFR.	BIND	1623525
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	ShcA interacts with EGFR.	BIND	8610109
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	ShcA interacts with the EGFR.	BIND	8577769 \|8610109 \|8943228
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	9544989
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	EGF-R interacts with Shc. This interaction was modelled on a demonstrated interaction between human EGF-R and mouse Shc.	BIND	8887653
SHC3	N-Shc \| NSHC \| RAI \| SHCC	SHC (Src homology 2 domain containing) transforming protein 3	-	HPRD,BioGRID	9507002
SNRPD2	SMD2 \| SNRPD1	small nuclear ribonucleoprotein D2 polypeptide 16.5kDa	-	HPRD	12577067
SNX1	HsT17379 \| MGC8664 \| SNX1A \| Vps5	sorting nexin 1	-	HPRD,BioGRID	8638121 \|9819414
SNX2	MGC5204 \| TRG-9	sorting nexin 2	-	HPRD,BioGRID	9819414
SNX4	-	sorting nexin 4	-	HPRD,BioGRID	9819414
SNX6	MGC3157 \| MSTP010 \| TFAF2	sorting nexin 6	-	HPRD,BioGRID	11279102
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	-	HPRD,BioGRID	12070153
SOCS3	ATOD4 \| CIS3 \| Cish3 \| MGC71791 \| SOCS-3 \| SSI-3 \| SSI3	suppressor of cytokine signaling 3	-	HPRD,BioGRID	12070153
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	-	HPRD,BioGRID	9447973
SOS2	FLJ25596	son of sevenless homolog 2 (Drosophila)	-	HPRD,BioGRID	10675333
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	10971656
STAT1	DKFZp686B04100 \| ISGF-3 \| STAT91	signal transducer and activator of transcription 1, 91kDa	-	HPRD,BioGRID	12070153
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	Affinity Capture-Western	BioGRID	10358079 \|15485908
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	Tyrosine phophorylated EGFR interacts with STAT3.	BIND	12873986
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	-	HPRD,BioGRID	10358079
STAT5B	STAT5	signal transducer and activator of transcription 5B	-	HPRD,BioGRID	10558875
TGFA	TFGA	transforming growth factor, alpha	-	HPRD,BioGRID	12297049
TJP1	DKFZp686M05161 \| MGC133289 \| ZO-1	tight junction protein 1 (zona occludens 1)	-	HPRD,BioGRID	12708492
TNC	HXB \| MGC167029 \| TN	tenascin C	-	HPRD	11470832
TNK2	ACK \| ACK1 \| FLJ44758 \| FLJ45547 \| p21cdc42Hs	tyrosine kinase, non-receptor, 2	-	HPRD	8497321 \|8647288
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	10938113
VAV2	-	vav 2 guanine nucleotide exchange factor	Tyrosine phosphorylated EGFR interacts with and phosphorylates Vav2.	BIND	12454019
VAV2	-	vav 2 guanine nucleotide exchange factor	-	HPRD,BioGRID	10618391 \|10938113
VAV3	FLJ40431	vav 3 guanine nucleotide exchange factor	Affinity Capture-Western	BioGRID	10938113
VAV3	FLJ40431	vav 3 guanine nucleotide exchange factor	-	HPRD	11094073
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	Affinity Capture-Western	BioGRID	9307968
XPO6	EXP6 \| FLJ22519 \| KIAA0370 \| RANBP20	exportin 6	-	HPRD	14592989
XRCC6	CTC75 \| CTCBF \| G22P1 \| KU70 \| ML8 \| TLAA	X-ray repair complementing defective repair in Chinese hamster cells 6	-	HPRD	9430697
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	EGFR interacts with 14-3-3-zeta.	BIND	15225635
ZNF259	MGC110983 \| ZPR1	zinc finger protein 259	-	HPRD	8650580 \|10938113\|10938113
ZNF259	MGC110983 \| ZPR1	zinc finger protein 259	-	HPRD	10938113

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION	267	161	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG DORSO VENTRAL AXIS FORMATION	25	21	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION	75	53	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
KEGG GNRH SIGNALING PATHWAY	101	77	All SZGR 2.0 genes in this pathway
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION	68	44	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG GLIOMA	65	56	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG MELANOMA	71	57	All SZGR 2.0 genes in this pathway
KEGG BLADDER CANCER	42	33	All SZGR 2.0 genes in this pathway
KEGG NON SMALL CELL LUNG CANCER	54	47	All SZGR 2.0 genes in this pathway
BIOCARTA AGR PATHWAY	36	31	All SZGR 2.0 genes in this pathway
BIOCARTA AT1R PATHWAY	36	28	All SZGR 2.0 genes in this pathway
BIOCARTA CBL PATHWAY	13	10	All SZGR 2.0 genes in this pathway
BIOCARTA EGF PATHWAY	31	25	All SZGR 2.0 genes in this pathway
BIOCARTA ERK PATHWAY	28	22	All SZGR 2.0 genes in this pathway
BIOCARTA KERATINOCYTE PATHWAY	46	38	All SZGR 2.0 genes in this pathway
BIOCARTA EGFR SMRTE PATHWAY	11	11	All SZGR 2.0 genes in this pathway
BIOCARTA MCALPAIN PATHWAY	25	16	All SZGR 2.0 genes in this pathway
BIOCARTA CARDIACEGF PATHWAY	18	16	All SZGR 2.0 genes in this pathway
BIOCARTA HER2 PATHWAY	22	17	All SZGR 2.0 genes in this pathway
BIOCARTA SPRY PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA TEL PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA TFF PATHWAY	21	15	All SZGR 2.0 genes in this pathway
ST G ALPHA I PATHWAY	35	29	All SZGR 2.0 genes in this pathway
ST ADRENERGIC	36	29	All SZGR 2.0 genes in this pathway
ST FAS SIGNALING PATHWAY	65	54	All SZGR 2.0 genes in this pathway
PID LYSOPHOSPHOLIPID PATHWAY	66	53	All SZGR 2.0 genes in this pathway
PID PTP1B PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID ARF6 PATHWAY	35	27	All SZGR 2.0 genes in this pathway
PID TCPTP PATHWAY	43	33	All SZGR 2.0 genes in this pathway
PID TXA2PATHWAY	57	43	All SZGR 2.0 genes in this pathway
PID SHP2 PATHWAY	58	46	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
PID ERBB1 RECEPTOR PROXIMAL PATHWAY	35	29	All SZGR 2.0 genes in this pathway
PID AJDISS 2PATHWAY	48	38	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID UPA UPAR PATHWAY	42	30	All SZGR 2.0 genes in this pathway
PID ECADHERIN KERATINOCYTE PATHWAY	21	19	All SZGR 2.0 genes in this pathway
PID ERBB NETWORK PATHWAY	15	13	All SZGR 2.0 genes in this pathway
PID ERBB1 INTERNALIZATION PATHWAY	41	35	All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY	42	34	All SZGR 2.0 genes in this pathway
PID A6B1 A6B4 INTEGRIN PATHWAY	46	35	All SZGR 2.0 genes in this pathway
PID SYNDECAN 3 PATHWAY	17	15	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4	90	67	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB2	101	78	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY CONSTITUTIVELY ACTIVE EGFR	18	13	All SZGR 2.0 genes in this pathway
REACTOME GRB2 EVENTS IN ERBB2 SIGNALING	22	20	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY EGFR IN CANCER	109	80	All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB2 SIGNALING	44	34	All SZGR 2.0 genes in this pathway
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK	205	136	All SZGR 2.0 genes in this pathway
REACTOME EGFR DOWNREGULATION	25	14	All SZGR 2.0 genes in this pathway
REACTOME GAB1 SIGNALOSOME	38	29	All SZGR 2.0 genes in this pathway
REACTOME SHC1 EVENTS IN EGFR SIGNALING	15	13	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME L1CAM INTERACTIONS	86	62	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL TRANSDUCTION BY L1	34	25	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS UP	137	94	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS DN	182	111	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN	198	110	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL UP	94	59	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 DN	48	28	All SZGR 2.0 genes in this pathway
NOJIMA SFRP2 TARGETS DN	25	18	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
PAPASPYRIDONOS UNSTABLE ATEROSCLEROTIC PLAQUE DN	43	29	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN	209	122	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP	171	112	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA BY DMOG UP	130	85	All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS DN	91	58	All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A AND HIF2A TARGETS DN	104	72	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS DN	136	94	All SZGR 2.0 genes in this pathway
MARKEY RB1 CHRONIC LOF DN	118	78	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F UP	185	119	All SZGR 2.0 genes in this pathway
OZANNE AP1 TARGETS UP	18	11	All SZGR 2.0 genes in this pathway
APPIERTO RESPONSE TO FENRETINIDE DN	51	35	All SZGR 2.0 genes in this pathway
BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER	22	19	All SZGR 2.0 genes in this pathway
SUZUKI AMPLIFIED IN ORAL CANCER	16	12	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 29	11	7	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
HONRADO BREAST CANCER BRCA1 VS BRCA2	18	12	All SZGR 2.0 genes in this pathway
SNIJDERS AMPLIFIED IN HEAD AND NECK TUMORS	37	27	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE NORMAL DN	33	27	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE IMMORTALIZED DN	31	26	All SZGR 2.0 genes in this pathway
HASINA NOL7 TARGETS DN	13	9	All SZGR 2.0 genes in this pathway
LIU NASOPHARYNGEAL CARCINOMA	70	38	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP	176	115	All SZGR 2.0 genes in this pathway
COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA DN	28	21	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 480 HELA	164	118	All SZGR 2.0 genes in this pathway
JEON SMAD6 TARGETS DN	19	14	All SZGR 2.0 genes in this pathway
SUNG METASTASIS STROMA DN	54	34	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA COPY NUMBER UP	75	36	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY	26	22	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 UP	140	85	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER CIPROFIBRATE DN	66	43	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC TGFA DN	65	44	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER ACOX1 DN	65	39	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC E2F1 DN	64	38	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC DN	63	40	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER E2F1 DN	64	42	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP	214	133	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL	293	160	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE DN	123	76	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C4	18	12	All SZGR 2.0 genes in this pathway
CHIBA RESPONSE TO TSA DN	23	14	All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN	271	175	All SZGR 2.0 genes in this pathway
SU PLACENTA	30	18	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO OR GAMMA RADIATION	15	13	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP	226	164	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
ZHANG GATA6 TARGETS DN	64	46	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR DN	191	123	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN UP	39	20	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
HUANG DASATINIB RESISTANCE UP	81	53	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
SEKI INFLAMMATORY RESPONSE LPS UP	77	56	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS DN	142	79	All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE DN	209	137	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS KERATINOCYTE UP	91	63	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP	84	60	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED RECURRENTLY	6	5	All SZGR 2.0 genes in this pathway
TCGA GLIOBLASTOMA MUTATED	8	8	All SZGR 2.0 genes in this pathway
GYORFFY DOXORUBICIN RESISTANCE	56	34	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3	266	180	All SZGR 2.0 genes in this pathway
NIELSEN SCHWANNOMA DN	18	9	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS LOW SERUM	100	51	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
OHGUCHI LIVER HNF4A TARGETS DN	149	85	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway
ZHU SKIL TARGETS UP	20	14	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS DN	157	105	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 3	20	9	All SZGR 2.0 genes in this pathway
PEDERSEN TARGETS OF 611CTF ISOFORM OF ERBB2	76	45	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
LIU IL13 PRIMING MODEL	15	11	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 PARTIAL	160	106	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE DN	99	74	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER CLUSTER 3	16	12	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	200	206	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	200	206	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-27	200	207	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	200	207	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EGFR