SZGR2

Summary ?

GeneID	2296
Symbol	FOXC1
Synonyms	ARA\|FKHL7\|FREAC-3\|FREAC3\|IGDA\|IHG1\|IRID1\|RIEG3
Description	forkhead box C1
Reference	MIM:601090\|HGNC:HGNC:3800\|Ensembl:ENSG00000054598\|HPRD:03054\|Vega:OTTHUMG00000016182
Gene type	protein-coding
Map location	6p25
Pascal p-value	0.307
Fetal beta	1.557
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0159
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg23867624	6	1610197	FOXC1	2.07E-8	-0.009	7.09E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs12530461	chr6	614352	FOXC1	2296	0.04	cis
rs1320385	chr1	54064468	FOXC1	2296	1.021E-4	trans
rs12036675	chr1	54066317	FOXC1	2296	1.021E-4	trans
rs12062528	chr1	54070830	FOXC1	2296	2.137E-4	trans
rs12561793	chr1	220647005	FOXC1	2296	0.16	trans
rs4522651	chr2	34048	FOXC1	2296	0	trans
rs17077856	chr3	45504326	FOXC1	2296	0.12	trans
rs2922180	chr3	125280472	FOXC1	2296	2.337E-6	trans
rs2976809	chr3	125451738	FOXC1	2296	0.03	trans
rs865499	chr3	165446956	FOXC1	2296	0.17	trans
rs1216383	chr4	129503677	FOXC1	2296	0.19	trans
rs7448349		0	FOXC1	2296	3.582E-5	trans
snp_a-2229839		0	FOXC1	2296	0	trans
rs248049	chr5	126489320	FOXC1	2296	0.13	trans
rs816736	chr5	154271947	FOXC1	2296	2.953E-5	trans
rs6934246	chr6	35154494	FOXC1	2296	0.02	trans
rs4711782	chr6	44363229	FOXC1	2296	0.1	trans
rs6455226	chr6	67930295	FOXC1	2296	0.2	trans
rs12056282	chr7	18882202	FOXC1	2296	0.07	trans
rs2739708	chr8	17992280	FOXC1	2296	0	trans
rs714131	chr8	17992832	FOXC1	2296	0.01	trans
rs10955813	chr8	118415080	FOXC1	2296	0.07	trans
rs10969120	chr9	29400711	FOXC1	2296	0.02	trans
rs4743989	chr9	97859191	FOXC1	2296	0.15	trans
rs651134	chr10	27549960	FOXC1	2296	0.03	trans
rs11006556	chr10	61287609	FOXC1	2296	0.15	trans
rs1159612	chr10	85329057	FOXC1	2296	0	trans
rs10886877	chr10	85425690	FOXC1	2296	0.16	trans
rs7071168	chr10	95829674	FOXC1	2296	0.01	trans
rs12572674	chr10	107733982	FOXC1	2296	0.07	trans
rs4612791	chr11	40768423	FOXC1	2296	0.05	trans
rs481843	chr11	116525866	FOXC1	2296	0.02	trans
rs2909003	chr12	12208768	FOXC1	2296	0.04	trans
rs11049036	chr12	27650292	FOXC1	2296	0.04	trans
rs7303819	chr12	33990776	FOXC1	2296	0.1	trans
rs10879027	chr12	70237156	FOXC1	2296	0.12	trans
rs11115813	chr12	83808239	FOXC1	2296	2.957E-4	trans
rs17073665	chr13	81541961	FOXC1	2296	0.01	trans
rs1457420	chr14	66958675	FOXC1	2296	0.1	trans
rs1872761	chr15	40003815	FOXC1	2296	0.18	trans
rs190183	chr15	97546708	FOXC1	2296	0.15	trans
rs17137819	chr16	5372534	FOXC1	2296	0.02	trans
rs16958302	chr16	57647432	FOXC1	2296	0.01	trans
rs9959804	chr18	20264142	FOXC1	2296	0	trans
rs17066440	chr18	57648274	FOXC1	2296	0.03	trans
rs17001072	chr19	11099774	FOXC1	2296	0.04	trans
rs6095741	chr20	48666589	FOXC1	2296	0	trans
rs7265852	chr20	48823717	FOXC1	2296	0.03	trans
rs5991662	chrX	43335796	FOXC1	2296	0.11	trans
rs1545676	chrX	93530472	FOXC1	2296	2.545E-4	trans
rs242163	chrX	132311662	FOXC1	2296	0.04	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PLXNA1	0.88	0.87
ZNF778	0.86	0.82
NAV1	0.86	0.85
CELSR3	0.86	0.81
CACNA1E	0.85	0.81
KIAA1549	0.85	0.82
DLG5	0.85	0.85
ZNF629	0.85	0.84
ANKS1A	0.85	0.83
AMMECR1L	0.84	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.57	-0.66
COPZ2	-0.55	-0.66
AF347015.31	-0.55	-0.72
AF347015.27	-0.54	-0.70
S100B	-0.54	-0.68
MT-CO2	-0.54	-0.71
HLA-F	-0.54	-0.57
AIFM3	-0.54	-0.58
TSC22D4	-0.53	-0.62
FXYD1	-0.53	-0.69

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003705	RNA polymerase II transcription factor activity, enhancer binding	IEA		-
GO:0008301	DNA bending activity	IDA		7957066
GO:0008134	transcription factor binding	IPI		15684392
GO:0016563	transcription activator activity	NAS		8499623
GO:0043565	sequence-specific DNA binding	IDA		7957066 \|15277473
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	IEA	Brain (GO term level: 7)	-
GO:0001568	blood vessel development	IEA		-
GO:0001501	skeletal system development	IEA		-
GO:0001503	ossification	IEA		-
GO:0001657	ureteric bud development	IEA		-
GO:0001701	in utero embryonic development	IEA		-
GO:0001541	ovarian follicle development	IEA		-
GO:0003007	heart morphogenesis	IEA		-
GO:0001822	kidney development	IEA		-
GO:0001945	lymph vessel development	IEA		-
GO:0001974	blood vessel remodeling	IEA		-
GO:0055010	ventricular cardiac muscle morphogenesis	IEA		-
GO:0006350	transcription	IEA		-
GO:0007219	Notch signaling pathway	IEA		-
GO:0008354	germ cell migration	IEA		-
GO:0014032	neural crest cell development	IEA		-
GO:0048010	vascular endothelial growth factor receptor signaling pathway	IEA		-
GO:0006916	anti-apoptosis	IEA		-
GO:0030203	glycosaminoglycan metabolic process	IEA		-
GO:0042475	odontogenesis of dentine-containing tooth	IMP		12614756
GO:0030199	collagen fibril organization	IEA		-
GO:0043010	camera-type eye development	IEA		-
GO:0035050	embryonic heart tube development	IEA		-
GO:0032808	lacrimal gland development	IEA		-
GO:0048341	paraxial mesoderm formation	IEA		-
GO:0045930	negative regulation of mitotic cell cycle	IDA		12408963
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0050880	regulation of blood vessel size	IEA		-
GO:0046620	regulation of organ growth	IEA		-
GO:0048844	artery morphogenesis	IEA		-
GO:0048762	mesenchymal cell differentiation	IEA		-
GO:0060038	cardiac muscle cell proliferation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IC		7957066
GO:0005634	nucleus	IDA		15277473 \|16449236
GO:0005720	nuclear heterochromatin	IDA		15684392

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN	391	222	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER CLASSES DN	34	26	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 DN	48	28	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN	74	44	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP	157	91	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
TOMIDA METASTASIS DN	18	11	All SZGR 2.0 genes in this pathway
WONG ENDMETRIUM CANCER UP	25	17	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 6HR	40	23	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL UP	83	51	All SZGR 2.0 genes in this pathway
DAWSON METHYLATED IN LYMPHOMA TCL1	59	45	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 LASER DN	50	38	All SZGR 2.0 genes in this pathway
LIU NASOPHARYNGEAL CARCINOMA	70	38	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 60 HELA	46	32	All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS	183	115	All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION UP	140	83	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
ZHENG RESPONSE TO ARSENITE DN	18	15	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP	244	151	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS UP	388	234	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
BRUECKNER TARGETS OF MIRLET7A3 UP	111	69	All SZGR 2.0 genes in this pathway
GU PDEF TARGETS DN	39	20	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN	240	153	All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2	356	214	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 6	33	22	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS	535	325	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 UP	87	52	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
SCHMIDT POR TARGETS IN LIMB BUD UP	26	21	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS UP	169	105	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN	244	157	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	1755	1761	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	1755	1761	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-133	538	544	1A	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	538	544	1A	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-137	1398	1405	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-138	160	167	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-138	160	167	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-204/211	619	626	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	619	626	1A,m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-24	1166	1172	1A	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-28	1681	1687	1A	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-320	746	752	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-330	928	935	1A,m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-374	612	618	1A	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-495	682	688	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-495	682	688	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	488	494	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FOXC1