SZGR2

Summary ?

GeneID	2956
Symbol	MSH6
Synonyms	GTBP\|GTMBP\|HNPCC5\|HSAP\|p160
Description	mutS homolog 6
Reference	MIM:600678\|HGNC:HGNC:7329\|Ensembl:ENSG00000116062\|HPRD:07202\|
Gene type	protein-coding
Map location	2p16
Pascal p-value	0.013
Sherlock p-value	0.295
Fetal beta	1.657
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0132

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07652213	2	48010362	MSH6		-0.03	0.25	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs9555862	chr13	87208015	MSH6	2956		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0000287	magnesium ion binding	IDA		16403449
GO:0000400	four-way junction DNA binding	IDA		12034830
GO:0000701	purine-specific mismatch base pair DNA N-glycosylase activity	IMP		11005803
GO:0003682	chromatin binding	IEA		-
GO:0003684	damaged DNA binding	IEA		-
GO:0005515	protein binding	IPI		14657349
GO:0005524	ATP binding	IDA		15105434
GO:0005524	ATP binding	IEA		-
GO:0016887	ATPase activity	IDA		16403449
GO:0032142	single guanine insertion binding	IDA		8942985
GO:0032143	single thymine insertion binding	IDA		8942985
GO:0030983	mismatched DNA binding	IEA		-
GO:0042803	protein homodimerization activity	IDA		8942985
GO:0032405	MutLalpha complex binding	IDA		16403449
GO:0032139	dinucleotide insertion or deletion binding	IMP		11005803
GO:0032137	guanine/thymine mispair binding	IDA		8942985 \|11809883
GO:0032137	guanine/thymine mispair binding	IEA		-
GO:0032357	oxidized purine DNA binding	IDA		11756455 \|11801590
GO:0043531	ADP binding	IDA		15105434
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006298	mismatch repair	IDA		10871409 \|11005803
GO:0006298	mismatch repair	IEA		-
GO:0006298	mismatch repair	IMP		8782829
GO:0008340	determination of adult life span	IEA		-
GO:0006284	base-excision repair	IDA		8942985
GO:0008630	DNA damage response, signal transduction resulting in induction of apoptosis	IEA		-
GO:0009411	response to UV	IEA		-
GO:0016446	somatic hypermutation of immunoglobulin genes	IEA		-
GO:0016447	somatic recombination of immunoglobulin gene segments	IEA		-
GO:0045910	negative regulation of DNA recombination	IEA		-
GO:0045190	isotype switching	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000790	nuclear chromatin	IEA		-
GO:0005634	nucleus	IEA		-
GO:0032301	MutSalpha complex	IDA		8942985
GO:0032301	MutSalpha complex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATM	AT1 \| ATA \| ATC \| ATD \| ATDC \| ATE \| DKFZp781A0353 \| MGC74674 \| TEL1 \| TELO1	ataxia telangiectasia mutated	Co-purification	BioGRID	10783165
BARD1	-	BRCA1 associated RING domain 1	Reconstituted Complex	BioGRID	11498787
BLM	BS \| MGC126616 \| MGC131618 \| MGC131620 \| RECQ2 \| RECQL2 \| RECQL3	Bloom syndrome	Co-purification	BioGRID	10783165
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 associates with MSH6.	BIND	10783165 \|11498787
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	11498787
CASP4	ICE(rel)II \| ICEREL-II \| ICH-2 \| Mih1/TX \| TX	caspase 4, apoptosis-related cysteine peptidase	Affinity Capture-MS	BioGRID	17353931
MLH1	COCA2 \| FCC2 \| HNPCC \| HNPCC2 \| MGC5172 \| hMLH1	mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)	Co-purification	BioGRID	10783165
MRE11A	ATLD \| HNGS1 \| MRE11 \| MRE11B	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	Co-purification	BioGRID	10783165
MSH2	COCA1 \| FCC1 \| HNPCC \| HNPCC1 \| LCFS2	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)	MSH2 interacts with MSH6.	BIND	15753043
MSH2	COCA1 \| FCC1 \| HNPCC \| HNPCC1 \| LCFS2	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)	MSH2 interacts with MSH6.	BIND	9428522
MSH2	COCA1 \| FCC1 \| HNPCC \| HNPCC1 \| LCFS2	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)	-	HPRD,BioGRID	8942985 \|9774676
MUTYH	MGC4416 \| MYH	mutY homolog (E. coli)	hMYH interacts with hMSH6.	BIND	11801590
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	Affinity Capture-MS	BioGRID	17353931
NBN	AT-V1 \| AT-V2 \| ATV \| FLJ10155 \| MGC87362 \| NBS \| NBS1 \| P95	nibrin	Co-purification	BioGRID	10783165
PCNA	MGC8367	proliferating cell nuclear antigen	-	HPRD	11005803 \|12171929
PCNA	MGC8367	proliferating cell nuclear antigen	Affinity Capture-MS Affinity Capture-Western Far Western Protein-peptide	BioGRID	11005803 \|11274057 \|12171929
PCNA	MGC8367	proliferating cell nuclear antigen	MSH6 is a PCNA-binding protein	BIND	12171929
RAD50	RAD50-2 \| hRad50	RAD50 homolog (S. cerevisiae)	Co-purification	BioGRID	10783165
RFC1	A1 \| MGC51786 \| MHCBFB \| PO-GA \| RECC1 \| RFC \| RFC140	replication factor C (activator 1) 1, 145kDa	Co-purification	BioGRID	10783165
SMC1A	CDLS2 \| DKFZp686L19178 \| DXS423E \| KIAA0178 \| MGC138332 \| SB1.8 \| SMC1 \| SMC1L1 \| SMC1alpha \| SMCB	structural maintenance of chromosomes 1A	Reconstituted Complex	BioGRID	14657349

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MISMATCH REPAIR	23	14	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP	633	376	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP	612	367	All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION DN	122	67	All SZGR 2.0 genes in this pathway
WAKASUGI HAVE ZNF143 BINDING SITES	58	33	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN	88	71	All SZGR 2.0 genes in this pathway
MATTIOLI MGUS VS PCL	116	62	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
KAUFFMANN MELANOMA RELAPSE UP	61	25	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP	236	139	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN	103	64	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES	230	137	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN	163	115	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM	302	191	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS DN	215	132	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO CANTHARIDIN DN	69	46	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC UP	202	115	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 16HR	40	24	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
LOPES METHYLATED IN COLON CANCER DN	28	26	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS DN	105	63	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN DN	249	165	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL DN	175	103	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL DN	113	76	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
STEIN ESRRA TARGETS	535	325	All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR DN	251	151	All SZGR 2.0 genes in this pathway
FOURNIER ACINAR DEVELOPMENT LATE 2	277	172	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS UP	162	86	All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER DN	116	83	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS GROWING	243	155	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN	374	217	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE MIDDLE	98	56	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP	570	339	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN	244	157	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway
ABRAMSON INTERACT WITH AIRE	45	33	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-142-5p	74	80	m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MSH6