Gene Page: MSH6
Summary ?
GeneID | 2956 |
Symbol | MSH6 |
Synonyms | GTBP|GTMBP|HNPCC5|HSAP|p160 |
Description | mutS homolog 6 |
Reference | MIM:600678|HGNC:HGNC:7329|Ensembl:ENSG00000116062|HPRD:07202| |
Gene type | protein-coding |
Map location | 2p16 |
Pascal p-value | 0.013 |
Sherlock p-value | 0.295 |
Fetal beta | 1.657 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0132 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg07652213 | 2 | 48010362 | MSH6 | -0.03 | 0.25 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs9555862 | chr13 | 87208015 | MSH6 | 2956 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IDA | 16403449 | |
GO:0000400 | four-way junction DNA binding | IDA | 12034830 | |
GO:0000701 | purine-specific mismatch base pair DNA N-glycosylase activity | IMP | 11005803 | |
GO:0003682 | chromatin binding | IEA | - | |
GO:0003684 | damaged DNA binding | IEA | - | |
GO:0005515 | protein binding | IPI | 14657349 | |
GO:0005524 | ATP binding | IDA | 15105434 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016887 | ATPase activity | IDA | 16403449 | |
GO:0032142 | single guanine insertion binding | IDA | 8942985 | |
GO:0032143 | single thymine insertion binding | IDA | 8942985 | |
GO:0030983 | mismatched DNA binding | IEA | - | |
GO:0042803 | protein homodimerization activity | IDA | 8942985 | |
GO:0032405 | MutLalpha complex binding | IDA | 16403449 | |
GO:0032139 | dinucleotide insertion or deletion binding | IMP | 11005803 | |
GO:0032137 | guanine/thymine mispair binding | IDA | 8942985 |11809883 | |
GO:0032137 | guanine/thymine mispair binding | IEA | - | |
GO:0032357 | oxidized purine DNA binding | IDA | 11756455 |11801590 | |
GO:0043531 | ADP binding | IDA | 15105434 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006298 | mismatch repair | IDA | 10871409 |11005803 | |
GO:0006298 | mismatch repair | IEA | - | |
GO:0006298 | mismatch repair | IMP | 8782829 | |
GO:0008340 | determination of adult life span | IEA | - | |
GO:0006284 | base-excision repair | IDA | 8942985 | |
GO:0008630 | DNA damage response, signal transduction resulting in induction of apoptosis | IEA | - | |
GO:0009411 | response to UV | IEA | - | |
GO:0016446 | somatic hypermutation of immunoglobulin genes | IEA | - | |
GO:0016447 | somatic recombination of immunoglobulin gene segments | IEA | - | |
GO:0045910 | negative regulation of DNA recombination | IEA | - | |
GO:0045190 | isotype switching | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000790 | nuclear chromatin | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0032301 | MutSalpha complex | IDA | 8942985 | |
GO:0032301 | MutSalpha complex | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ATM | AT1 | ATA | ATC | ATD | ATDC | ATE | DKFZp781A0353 | MGC74674 | TEL1 | TELO1 | ataxia telangiectasia mutated | Co-purification | BioGRID | 10783165 |
BARD1 | - | BRCA1 associated RING domain 1 | Reconstituted Complex | BioGRID | 11498787 |
BLM | BS | MGC126616 | MGC131618 | MGC131620 | RECQ2 | RECQL2 | RECQL3 | Bloom syndrome | Co-purification | BioGRID | 10783165 |
BRCA1 | BRCAI | BRCC1 | IRIS | PSCP | RNF53 | breast cancer 1, early onset | BRCA1 associates with MSH6. | BIND | 10783165 |11498787 |
BRCA1 | BRCAI | BRCC1 | IRIS | PSCP | RNF53 | breast cancer 1, early onset | - | HPRD,BioGRID | 11498787 |
CASP4 | ICE(rel)II | ICEREL-II | ICH-2 | Mih1/TX | TX | caspase 4, apoptosis-related cysteine peptidase | Affinity Capture-MS | BioGRID | 17353931 |
MLH1 | COCA2 | FCC2 | HNPCC | HNPCC2 | MGC5172 | hMLH1 | mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) | Co-purification | BioGRID | 10783165 |
MRE11A | ATLD | HNGS1 | MRE11 | MRE11B | MRE11 meiotic recombination 11 homolog A (S. cerevisiae) | Co-purification | BioGRID | 10783165 |
MSH2 | COCA1 | FCC1 | HNPCC | HNPCC1 | LCFS2 | mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) | MSH2 interacts with MSH6. | BIND | 15753043 |
MSH2 | COCA1 | FCC1 | HNPCC | HNPCC1 | LCFS2 | mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) | MSH2 interacts with MSH6. | BIND | 9428522 |
MSH2 | COCA1 | FCC1 | HNPCC | HNPCC1 | LCFS2 | mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) | - | HPRD,BioGRID | 8942985 |9774676 |
MUTYH | MGC4416 | MYH | mutY homolog (E. coli) | hMYH interacts with hMSH6. | BIND | 11801590 |
MYC | bHLHe39 | c-Myc | v-myc myelocytomatosis viral oncogene homolog (avian) | Affinity Capture-MS | BioGRID | 17353931 |
NBN | AT-V1 | AT-V2 | ATV | FLJ10155 | MGC87362 | NBS | NBS1 | P95 | nibrin | Co-purification | BioGRID | 10783165 |
PCNA | MGC8367 | proliferating cell nuclear antigen | - | HPRD | 11005803 |12171929 |
PCNA | MGC8367 | proliferating cell nuclear antigen | Affinity Capture-MS Affinity Capture-Western Far Western Protein-peptide | BioGRID | 11005803 |11274057 |12171929 |
PCNA | MGC8367 | proliferating cell nuclear antigen | MSH6 is a PCNA-binding protein | BIND | 12171929 |
RAD50 | RAD50-2 | hRad50 | RAD50 homolog (S. cerevisiae) | Co-purification | BioGRID | 10783165 |
RFC1 | A1 | MGC51786 | MHCBFB | PO-GA | RECC1 | RFC | RFC140 | replication factor C (activator 1) 1, 145kDa | Co-purification | BioGRID | 10783165 |
SMC1A | CDLS2 | DKFZp686L19178 | DXS423E | KIAA0178 | MGC138332 | SB1.8 | SMC1 | SMC1L1 | SMC1alpha | SMCB | structural maintenance of chromosomes 1A | Reconstituted Complex | BioGRID | 14657349 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MISMATCH REPAIR | 23 | 14 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG COLORECTAL CANCER | 62 | 47 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
MISSIAGLIA REGULATED BY METHYLATION DN | 122 | 67 | All SZGR 2.0 genes in this pathway |
WAKASUGI HAVE ZNF143 BINDING SITES | 58 | 33 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN | 88 | 71 | All SZGR 2.0 genes in this pathway |
MATTIOLI MGUS VS PCL | 116 | 62 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
PUJANA BREAST CANCER LIT INT NETWORK | 101 | 73 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
KAUFFMANN MELANOMA RELAPSE UP | 61 | 25 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN | 103 | 64 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 DN | 163 | 115 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO CANTHARIDIN DN | 69 | 46 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC UP | 202 | 115 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS PEAK AT 16HR | 40 | 24 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
LOPES METHYLATED IN COLON CANCER DN | 28 | 26 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS DN | 105 | 63 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR DN | 277 | 166 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SURVIVAL DN | 113 | 76 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR DN | 251 | 151 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
WINNEPENNINCKX MELANOMA METASTASIS UP | 162 | 86 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE MIDDLE | 98 | 56 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
ABRAMSON INTERACT WITH AIRE | 45 | 33 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-142-5p | 74 | 80 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.