SZGR2

Summary ?

GeneID	3778
Symbol	KCNMA1
Synonyms	BKTM\|KCa1.1\|MaxiK\|SAKCA\|SLO\|SLO-ALPHA\|SLO1\|bA205K10.1\|mSLO1
Description	potassium calcium-activated channel subfamily M alpha 1
Reference	MIM:600150\|HGNC:HGNC:6284\|Ensembl:ENSG00000156113\|HPRD:15967\|Vega:OTTHUMG00000018543
Gene type	protein-coding
Map location	10q22.3
Pascal p-value	0.011
Sherlock p-value	0.02
Fetal beta	-1.818
eGene	Nucleus accumbens basal ganglia Putamen basal ganglia Myers' cis & trans
Support	EXCITABILITY G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs877123	chr2	69944159	KCNMA1	3778		0.17		trans
rs17285269	chr5	36402793	KCNMA1	3778		0.02		trans
rs2199402	chr8	9201002	KCNMA1	3778		0.12		trans
rs7841407	chr8	9243427	KCNMA1	3778		0.04		trans
rs3848445	chr17	14294020	KCNMA1	3778		0.03		trans
rs2673454	10	79363349	KCNMA1	ENSG00000156113.16	1.981E-6	0	35004	gtex_brain_putamen_basal
rs2673436	10	79363388	KCNMA1	ENSG00000156113.16	3.576E-7	0	34965	gtex_brain_putamen_basal
rs1473966	10	79363798	KCNMA1	ENSG00000156113.16	3.815E-7	0	34555	gtex_brain_putamen_basal
rs397775043	10	79364298	KCNMA1	ENSG00000156113.16	3.325E-7	0	34055	gtex_brain_putamen_basal
rs2670166	10	79365663	KCNMA1	ENSG00000156113.16	3.815E-7	0	32690	gtex_brain_putamen_basal
rs2619632	10	79365833	KCNMA1	ENSG00000156113.16	3.815E-7	0	32520	gtex_brain_putamen_basal
rs2673463	10	79369794	KCNMA1	ENSG00000156113.16	2.978E-7	0	28559	gtex_brain_putamen_basal
rs2670128	10	79369911	KCNMA1	ENSG00000156113.16	7.378E-7	0	28442	gtex_brain_putamen_basal
rs2246003	10	79370534	KCNMA1	ENSG00000156113.16	7.378E-7	0	27819	gtex_brain_putamen_basal
rs1877993	10	79373447	KCNMA1	ENSG00000156113.16	2.978E-7	0	24906	gtex_brain_putamen_basal
rs2619627	10	79374202	KCNMA1	ENSG00000156113.16	7.888E-8	0	24151	gtex_brain_putamen_basal
rs2619625	10	79376660	KCNMA1	ENSG00000156113.16	2.035E-7	0	21693	gtex_brain_putamen_basal
rs2673489	10	79377675	KCNMA1	ENSG00000156113.16	7.888E-8	0	20678	gtex_brain_putamen_basal
rs2673488	10	79377940	KCNMA1	ENSG00000156113.16	2.035E-7	0	20413	gtex_brain_putamen_basal
rs2673487	10	79378014	KCNMA1	ENSG00000156113.16	2.035E-7	0	20339	gtex_brain_putamen_basal
rs2619624	10	79379375	KCNMA1	ENSG00000156113.16	2.093E-7	0	18978	gtex_brain_putamen_basal
rs2280165	10	79380642	KCNMA1	ENSG00000156113.16	2.191E-7	0	17711	gtex_brain_putamen_basal
rs2395501	10	79382539	KCNMA1	ENSG00000156113.16	2.591E-7	0	15814	gtex_brain_putamen_basal
rs2255727	10	79383138	KCNMA1	ENSG00000156113.16	2.422E-7	0	15215	gtex_brain_putamen_basal
rs2255725	10	79383210	KCNMA1	ENSG00000156113.16	3.973E-6	0	15143	gtex_brain_putamen_basal
rs2619621	10	79385070	KCNMA1	ENSG00000156113.16	1.192E-6	0	13283	gtex_brain_putamen_basal
rs734949	10	79387112	KCNMA1	ENSG00000156113.16	2.603E-7	0	11241	gtex_brain_putamen_basal
rs10824556	10	79389828	KCNMA1	ENSG00000156113.16	8.202E-7	0	8525	gtex_brain_putamen_basal
rs7098001	10	79391115	KCNMA1	ENSG00000156113.16	1.565E-6	0	7238	gtex_brain_putamen_basal
rs2673406	10	79391584	KCNMA1	ENSG00000156113.16	2.5E-6	0	6769	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000287	magnesium ion binding	IEA		-
GO:0003824	catalytic activity	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IPI		10692449 \|15528406
GO:0005244	voltage-gated ion channel activity	IEA		-
GO:0005249	voltage-gated potassium channel activity	IDA		7877450 \|12388065
GO:0015269	calcium-activated potassium channel activity	IEA		-
GO:0030955	potassium ion binding	IEA		-
GO:0060072	large conductance calcium-activated potassium channel activity	IDA		7993625
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	ISS	neuron, Synap, Neurotransmitter (GO term level: 6)	-
GO:0019228	regulation of action potential in neuron	ISS	neuron (GO term level: 10)	-
GO:0001666	response to hypoxia	IDA		15528406
GO:0030007	cellular potassium ion homeostasis	IDA		11245614
GO:0048469	cell maturation	ISS		-
GO:0008152	metabolic process	IEA		-
GO:0007628	adult walking behavior	ISS		-
GO:0007623	circadian rhythm	ISS		-
GO:0007605	sensory perception of sound	ISS		-
GO:0007605	sensory perception of sound	ISS		-
GO:0006811	ion transport	IEA		-
GO:0006813	potassium ion transport	IDA		7573516 \|7877450 \|11245614 \|12388065 \|17706472 \|18458941
GO:0006813	potassium ion transport	IEA		-
GO:0006970	response to osmotic stress	IDA		10840032 \|12388065
GO:0043065	positive regulation of apoptosis	IMP		11245614
GO:0042391	regulation of membrane potential	IDA		7877450 \|7993625
GO:0050885	neuromuscular process controlling balance	ISS		-
GO:0032344	regulation of aldosterone metabolic process	ISS		-
GO:0034465	response to carbon monoxide	IDA		15528406
GO:0034465	response to carbon monoxide	IMP		18180950
GO:0042491	auditory receptor cell differentiation	ISS		-
GO:0045794	negative regulation of cell volume	IDA		12388065
GO:0046541	saliva secretion	ISS		-
GO:0060083	smooth muscle contraction involved in micturition	IDA		11641143
GO:0060082	eye blink reflex	ISS		-
GO:0060087	relaxation of vascular smooth muscle	ISS		-
GO:0045475	locomotor rhythm	ISS		-
GO:0051592	response to calcium ion	IDA		12388065 \|18458941
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043195	terminal button	ISS	axon, Synap, Neurotransmitter (GO term level: 8)	-
GO:0045211	postsynaptic membrane	ISS	Synap, Neurotransmitter (GO term level: 5)	-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IDA		7573516 \|7877450
GO:0009897	external side of plasma membrane	ISS		-
GO:0008076	voltage-gated potassium channel complex	IDA		7573516 \|7877450
GO:0016324	apical plasma membrane	IDA		10840032

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION	115	81	All SZGR 2.0 genes in this pathway
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP	205	140	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN	481	290	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA UP	294	178	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER CLASSES UP	72	38	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN	205	127	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA DN	77	52	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN DN	172	112	All SZGR 2.0 genes in this pathway
TANAKA METHYLATED IN ESOPHAGEAL CARCINOMA	103	58	All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER DN	54	37	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP	256	159	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 UP	140	85	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 3 UP	17	11	All SZGR 2.0 genes in this pathway
ONDER CDH1 SIGNALING VIA CTNNB1	83	58	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS POSTNATAL	63	50	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR DN	148	102	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2	43	38	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
JIANG AGING CEREBRAL CORTEX DN	54	43	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5	482	296	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE UP	66	44	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP	149	85	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP	418	282	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP	408	276	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3	142	103	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS GROWING	243	155	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP D	280	158	All SZGR 2.0 genes in this pathway
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP	121	70	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 UP	87	52	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP	289	184	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-138	1336	1342	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-138	1336	1342	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-181	121	127	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-203.1	2027	2033	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-204/211	558	564	1A	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	558	564	1A	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-224	187	193	m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-29	8119	8125	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-299-3p	48	54	m8	hsa-miR-299-3p	UAUGUGGGAUGGUAAACCGCUU
miR-33	448	455	1A,m8	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	448	455	1A,m8	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-338	8115	8121	m8	hsa-miR-338^brain	UCCAGCAUCAGUGAUUUUGUUGA
miR-34b	7858	7864	1A	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-380-5p	66	72	1A	hsa-miR-380-5p	UGGUUGACCAUAGAACAUGCGC
miR-380-5p	66	72	1A	hsa-miR-563	AGGUUGACAUACGUUUCCC
miR-409-3p	23	30	1A,m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-496	1584	1590	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-543	122	128	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: KCNMA1