SZGR2

Summary ?

GeneID	4086
Symbol	SMAD1
Synonyms	BSP-1\|BSP1\|JV4-1\|JV41\|MADH1\|MADR1
Description	SMAD family member 1
Reference	MIM:601595\|HGNC:HGNC:6767\|HPRD:03356\|
Gene type	protein-coding
Map location	4q31
Pascal p-value	0.039
Sherlock p-value	0.902
eGene	Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs11100879	chr4	146360411	SMAD1	4086	0.01	cis
rs11100883	chr4	146450969	SMAD1	4086	1.967E-4	cis
rs2036138	chr4	146484861	SMAD1	4086	2.383E-9	cis
rs11100883	chr4	146450969	SMAD1	4086	0.02	trans
rs2036138	chr4	146484861	SMAD1	4086	5.76E-7	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLC25A18	0.50	0.59
P2RY14	0.50	0.56
AC011427.1	0.50	0.57
GLUL	0.49	0.58
NDRG2	0.48	0.58
ALDOC	0.48	0.56
ADHFE1	0.48	0.54
GPER	0.48	0.58
SNTA1	0.48	0.57
CLDN10	0.48	0.58

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SAAL1	-0.46	-0.57
CNOT10	-0.46	-0.54
TRA2A	-0.46	-0.51
PGBD1	-0.46	-0.51
USPL1	-0.46	-0.54
ZNF589	-0.46	-0.50
RAE1	-0.46	-0.51
ZNF329	-0.46	-0.49
ZNF182	-0.46	-0.50
ZNF509	-0.45	-0.50

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005057	receptor signaling protein activity	NAS		8653785 \|10708949
GO:0003700	transcription factor activity	IEA		-
GO:0003702	RNA polymerase II transcription factor activity	IEA		-
GO:0005515	protein binding	IPI		15781469
GO:0016563	transcription activator activity	NAS		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030902	hindbrain development	IEA	Brain (GO term level: 8)	-
GO:0030901	midbrain development	IEA	Brain (GO term level: 8)	-
GO:0000165	MAPKKK cascade	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0007165	signal transduction	NAS		9759503
GO:0007179	transforming growth factor beta receptor signaling pathway	NAS		8663601
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0009880	embryonic pattern specification	ISS		-
GO:0007276	gamete generation	IEA		-
GO:0042592	homeostatic process	IEA		-
GO:0030509	BMP signaling pathway	EXP		15621726
GO:0030509	BMP signaling pathway	ISS		-
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		9436979 \|17356069
GO:0005622	intracellular	IEA		-
GO:0005622	intracellular	NAS		10647776
GO:0005634	nucleus	NAS		9759503
GO:0005654	nucleoplasm	EXP		11121043
GO:0005667	transcription factor complex	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0016021	integral to membrane	NAS		8663601

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACVR1	ACTRI \| ACVR1A \| ACVRLK2 \| ALK2 \| FOP \| SKR1 \| TSRI	activin A receptor, type I	-	HPRD	9748228 \|10583507 \|10652350
ACVR1	ACTRI \| ACVR1A \| ACVRLK2 \| ALK2 \| FOP \| SKR1 \| TSRI	activin A receptor, type I	Affinity Capture-Western	BioGRID	9748228 \|10652350
BMP7	OP-1	bone morphogenetic protein 7	Phenotypic Suppression	BioGRID	11438941
BMPR1A	10q23del \| ACVRLK3 \| ALK3 \| CD292	bone morphogenetic protein receptor, type IA	-	HPRD	11438941
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	Affinity Capture-Western	BioGRID	10673036 \|11239394
DVL1	DVL \| MGC54245	dishevelled, dsh homolog 1 (Drosophila)	Reconstituted Complex	BioGRID	12650946
ECSIT	SITPEC	ECSIT homolog (Drosophila)	-	HPRD	14633973
EP300	KAT3B \| p300	E1A binding protein p300	-	HPRD,BioGRID	10673036
ERBB2IP	ERBIN \| LAP2	erbb2 interacting protein	-	HPRD,BioGRID	12650946
FOXG1	BF1 \| BF2 \| FHKL3 \| FKH2 \| FKHL1 \| FKHL2 \| FKHL3 \| FKHL4 \| FOXG1A \| FOXG1B \| FOXG1C \| HBF-1 \| HBF-2 \| HBF-3 \| HBF-G2 \| HBF2 \| HFK1 \| HFK2 \| HFK3 \| KHL2 \| QIN	forkhead box G1	-	HPRD,BioGRID	11387330
GDF6	BMP13 \| CDMP2 \| KFS \| KFSL \| MGC158100 \| MGC158101 \| SGM1	growth differentiation factor 6	-	HPRD	15246821
GLI3	ACLS \| GCPS \| PAP-A \| PAPA \| PAPA1 \| PAPB \| PHS \| PPDIV	GLI-Kruppel family member GLI3	-	HPRD	9843199
HIPK2	DKFZp686K02111 \| FLJ23711 \| PRO0593	homeodomain interacting protein kinase 2	-	HPRD,BioGRID	12874272
HOXC8	HOX3 \| HOX3A	homeobox C8	-	HPRD,BioGRID	10224145 \|11139569
LEF1	DKFZp586H0919 \| TCF1ALPHA	lymphoid enhancer-binding factor 1	-	HPRD,BioGRID	10890911
LEMD3	MAN1	LEM domain containing 3	LEMD3 interacts with Smad1. This interaction was modelled on a demonstrated interaction between human LEMD3 and mouse Smad1.	BIND	15489854
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	-	HPRD,BioGRID	11118211
NEUROG1	AKA \| Math4C \| NEUROD3 \| bHLHa6 \| ngn1	neurogenin 1	-	HPRD,BioGRID	11239394
OAZ3	AZ3 \| OAZ-t \| TISP15	ornithine decarboxylase antizyme 3	Two-hybrid	BioGRID	11438941
PARD3B	ALS2CR19 \| MGC16131 \| PAR3B \| PAR3L \| PAR3LC \| PAR3beta \| Par3Lb	par-3 partitioning defective 3 homolog B (C. elegans)	Reconstituted Complex	BioGRID	12650946
PSMB4	HN3 \| HsN3 \| PROS26	proteasome (prosome, macropain) subunit, beta type, 4	-	HPRD,BioGRID	12097147
RAN	ARA24 \| Gsp1 \| TC4	RAN, member RAS oncogene family	SMAD1 interacts with RAN. This interaction was modeled on a demonstrated interaction between human SMAD1 and mouse RAN.	BIND	15761153
RPS27A	CEP80 \| HUBCEP80 \| UBA80 \| UBCEP1 \| UBCEP80	ribosomal protein S27a	Two-hybrid	BioGRID	11438941
RUNX1	AML1 \| AML1-EVI-1 \| AMLCR1 \| CBFA2 \| EVI-1 \| PEBP2aB	runt-related transcription factor 1	Affinity Capture-Western	BioGRID	10531362
RUNX2	AML3 \| CBFA1 \| CCD \| CCD1 \| MGC120022 \| MGC120023 \| OSF2 \| PEA2aA \| PEBP2A1 \| PEBP2A2 \| PEBP2aA \| PEBP2aA1	runt-related transcription factor 2	Affinity Capture-Western	BioGRID	10531362 \|10962029
RUNX3	AML2 \| CBFA3 \| FLJ34510 \| MGC16070 \| PEBP2aC	runt-related transcription factor 3	Affinity Capture-Western	BioGRID	10531362
SKI	SKV	v-ski sarcoma viral oncogene homolog (avian)	Affinity Capture-Western Reconstituted Complex	BioGRID	12874272
SKIL	SNO \| SnoA \| SnoN	SKI-like oncogene	Smad1 interacts with SnoN. This interaction was modeled on a demonstrated interaction between SnoN from an unspecified source and human Smad1.	BIND	12426322
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	-	HPRD	10400705 \|11700304
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	Affinity Capture-Western Co-fractionation	BioGRID	10531362 \|11700304 \|12874272
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	Smad4 interacts with Smad1.	BIND	15761153
SMAD6	HsT17432 \| MADH6 \| MADH7	SMAD family member 6	-	HPRD	11483516
SMURF2	DKFZp686F0270 \| MGC138150	SMAD specific E3 ubiquitin protein ligase 2	SMAD1 interacts with SMURF2.	BIND	15761153
SMURF2	DKFZp686F0270 \| MGC138150	SMAD specific E3 ubiquitin protein ligase 2	-	HPRD,BioGRID	11016919
SNIP1	FLJ12553 \| RP3-423B22.3 \| dJ423B22.2	Smad nuclear interacting protein 1	-	HPRD,BioGRID	10887155
SNX6	MGC3157 \| MSTP010 \| TFAF2	sorting nexin 6	-	HPRD	11279102
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	Affinity Capture-Western	BioGRID	10205054
STUB1	CHIP \| HSPABP2 \| NY-CO-7 \| SDCCAG7 \| UBOX1	STIP1 homology and U-box containing protein 1	Smad1 interacts with CHIP. This interaction was modeled on a demonstrated interaction between Smad1 and CHIP, both from an unspecified species.	BIND	15708501
TGIF1	HPE4 \| MGC39747 \| MGC5066 \| TGIF	TGFB-induced factor homeobox 1	Affinity Capture-Western	BioGRID	10199400
TOB1	APRO6 \| MGC104792 \| MGC34446 \| PIG49 \| TOB \| TROB \| TROB1	transducer of ERBB2, 1	-	HPRD,BioGRID	11163184
UBA52	CEP52 \| HUBCEP52 \| MGC126879 \| MGC126881 \| MGC57125 \| RPL40	ubiquitin A-52 residue ribosomal protein fusion product 1	Two-hybrid	BioGRID	11438941
XPO1	CRM1 \| DKFZp686B1823	exportin 1 (CRM1 homolog, yeast)	-	HPRD	12519765
ZEB1	AREB6 \| BZP \| DELTA-EF1 \| MGC133261 \| NIL-2-A \| NIL-2A \| NIL2A \| TCF8 \| ZEB \| ZFHEP \| ZFHX1A	zinc finger E-box binding homeobox 1	Affinity Capture-Western	BioGRID	12743038
ZEB2	KIAA0569 \| SIP-1 \| SIP1 \| SMADIP1 \| ZFHX1B	zinc finger E-box binding homeobox 2	-	HPRD	10400677
ZNF423	Ebfaz \| KIAA0760 \| MGC138520 \| MGC138522 \| OAZ \| Roaz \| ZFP423 \| Zfp104	zinc finger protein 423	-	HPRD,BioGRID	10660046
ZNF521	DKFZp564D0764 \| EHZF \| Evi3 \| MGC142182 \| MGC142208	zinc finger protein 521	-	HPRD	14630787
ZNF8	HF.18 \| Zfp128	zinc finger protein 8	-	HPRD	12370310

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG TGF BETA SIGNALING PATHWAY	86	64	All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY	37	29	All SZGR 2.0 genes in this pathway
BIOCARTA CTCF PATHWAY	23	18	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
PID ALK1 PATHWAY	26	21	All SZGR 2.0 genes in this pathway
PID ALK2 PATHWAY	11	9	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY BMP	23	15	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN	284	156	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP	316	190	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP	128	95	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP	117	84	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR	43	35	All SZGR 2.0 genes in this pathway
TURJANSKI MAPK1 AND MAPK2 TARGETS	12	10	All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION UP	88	58	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION UP	69	55	All SZGR 2.0 genes in this pathway
MORI PLASMA CELL DN	33	20	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP	87	67	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
IGLESIAS E2F TARGETS UP	151	103	All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS UP	206	118	All SZGR 2.0 genes in this pathway
MCCLUNG DELTA FOSB TARGETS 2WK	48	36	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN DN	51	32	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN	108	68	All SZGR 2.0 genes in this pathway
MATZUK EMBRYONIC GERM CELL	19	16	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL DN	216	143	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN	252	155	All SZGR 2.0 genes in this pathway
GU PDEF TARGETS UP	71	49	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE DN	69	48	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP	80	54	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA LB DN	44	23	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
KANG AR TARGETS DN	19	12	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-182	1008	1015	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-205	50	56	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-26	46	53	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
				hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-30-5p	206	212	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
				hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-370	255	261	1A	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-96	1009	1015	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SMAD1