SZGR2

Summary ?

GeneID	4851
Symbol	NOTCH1
Synonyms	AOS5\|AOVD1\|TAN1\|hN1
Description	notch 1
Reference	MIM:190198\|HGNC:HGNC:7881\|Ensembl:ENSG00000148400\|HPRD:01827\|Vega:OTTHUMG00000020935
Gene type	protein-coding
Map location	9q34.3
Pascal p-value	0.084
Sherlock p-value	0.719
Fetal beta	0.871
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.062

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
NOTCH1	chr9	139391864	G	A	NM_017617	.	silent			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZNF384	0.95	0.96
SAP130	0.95	0.95
PPIL2	0.94	0.95
PPRC1	0.94	0.95
PHF12	0.94	0.96
POGZ	0.94	0.96
QRICH1	0.94	0.95
ZNF142	0.94	0.95
C5orf25	0.93	0.93
GTF3C2	0.93	0.95

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.77	-0.87
MT-CO2	-0.75	-0.86
AF347015.27	-0.75	-0.85
AF347015.33	-0.72	-0.81
IFI27	-0.72	-0.82
MT-CYB	-0.72	-0.82
AF347015.21	-0.72	-0.93
C5orf53	-0.72	-0.74
AF347015.8	-0.71	-0.84
FXYD1	-0.71	-0.82

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IPI		10713164
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0007219	Notch signaling pathway	TAS		10713164
GO:0006955	immune response	NAS		1831692
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
GO:0050793	regulation of developmental process	IEA		-
GO:0045662	negative regulation of myoblast differentiation	IMP		10713164
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		10713164
GO:0016021	integral to membrane	NAS		-
GO:0005886	plasma membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APBA1	D9S411E \| MINT1 \| X11 \| X11A \| X11ALPHA	amyloid beta (A4) precursor protein-binding, family A, member 1	Notch1 interacts with X11-alpha. This interaction was modelled on a demonstrated interaction between mouse Notch1 and human X11-alpha.	BIND	14756819
CNTN1	F3 \| GP135	contactin 1	-	HPRD,BioGRID	14567914
DLL1	DELTA1 \| DL1 \| Delta	delta-like 1 (Drosophila)	Reconstituted Complex	BioGRID	11006133
DLL4	MGC126344 \| hdelta2	delta-like 4 (Drosophila)	-	HPRD	10837024 \|11739188
DTX1	hDx-1	deltex homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	11564735
DTX2	KIAA1528 \| MGC71098 \| RNF58	deltex homolog 2 (Drosophila)	-	HPRD	11226752
FBXW7	AGO \| CDC4 \| DKFZp686F23254 \| FBW6 \| FBW7 \| FBX30 \| FBXO30 \| FBXW6 \| FLJ16457 \| SEL-10 \| SEL10	F-box and WD repeat domain containing 7	-	HPRD,BioGRID	11425854 \|11585921
GSK3B	-	glycogen synthase kinase 3 beta	-	HPRD,BioGRID	12123574
ITCH	AIF4 \| AIP4 \| NAPP1 \| dJ468O1.1	itchy E3 ubiquitin protein ligase homolog (mouse)	-	HPRD	12682059
JAG1	AGS \| AHD \| AWS \| CD339 \| HJ1 \| JAGL1 \| MGC104644	jagged 1 (Alagille syndrome)	-	HPRD,BioGRID	11006133
JAG2	HJ2 \| SER2	jagged 2	-	HPRD,BioGRID	11006133
KAT2B	CAF \| P \| P/CAF \| PCAF	K(lysine) acetyltransferase 2B	-	HPRD	10747963
LCK	YT16 \| p56lck \| pp58lck	lymphocyte-specific protein tyrosine kinase	-	HPRD,BioGRID	14583609
LEF1	DKFZp586H0919 \| TCF1ALPHA	lymphoid enhancer-binding factor 1	-	HPRD,BioGRID	11604490
LFNG	SCDO3	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	-	HPRD	10935626 \|12486116
MAML1	KIAA0200 \| Mam-1 \| Mam1	mastermind-like 1 (Drosophila)	-	HPRD,BioGRID	11101851
MAML2	DKFZp686N0150 \| KIAA1819 \| MAM-3 \| MAM2 \| MAM3 \| MGC176701 \| MLL-MAML2	mastermind-like 2 (Drosophila)	Two-hybrid	BioGRID	12370315
MAML3	CAGH3 \| ERDA3 \| GDN \| MAM-2 \| MAM2 \| TNRC3	mastermind-like 3 (Drosophila)	Two-hybrid	BioGRID	12370315
MFNG	-	MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	-	HPRD	10935626 \|12486116
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	-	HPRD,BioGRID	8642313 \|11418662
NOTCH1	TAN1 \| hN1	Notch homolog 1, translocation-associated (Drosophila)	-	HPRD,BioGRID	10669757
NOTCH3	CADASIL \| CASIL	Notch homolog 3 (Drosophila)	Phenotypic Suppression	BioGRID	11404076
NOV	CCN3 \| IGFBP9	nephroblastoma overexpressed gene	-	HPRD,BioGRID	12050162
NUMB	S171	numb homolog (Drosophila)	-	HPRD,BioGRID	8755477 \|12682059
PIK3CA	MGC142161 \| MGC142163 \| PI3K \| p110-alpha	phosphoinositide-3-kinase, catalytic, alpha polypeptide	Affinity Capture-Western	BioGRID	14583609
PIK3CG	PI3CG \| PI3K \| PI3Kgamma \| PIK3	phosphoinositide-3-kinase, catalytic, gamma polypeptide	-	HPRD	14583609
PSEN1	AD3 \| FAD \| PS1 \| S182	presenilin 1	Affinity Capture-Western	BioGRID	10077672
RBPJ	CBF1 \| IGKJRB \| IGKJRB1 \| KBF2 \| MGC61669 \| RBP-J \| RBPJK \| RBPSUH \| SUH \| csl	recombination signal binding protein for immunoglobulin kappa J region	-	HPRD,BioGRID	8749394 \|9111040 \|10637481
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD,BioGRID	8642313
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD,BioGRID	14638857
SNW1	Bx42 \| MGC119379 \| NCOA-62 \| PRPF45 \| Prp45 \| SKIIP \| SKIP	SNW domain containing 1	SKIP interacts with Notch. This interaction was modeled on a demonstrated interaction between human SKIP and mouse Notch.	BIND	15546612
SNW1	Bx42 \| MGC119379 \| NCOA-62 \| PRPF45 \| Prp45 \| SKIIP \| SKIP	SNW domain containing 1	Reconstituted Complex Two-hybrid	BioGRID	11404076
XRCC6	CTC75 \| CTCBF \| G22P1 \| KU70 \| ML8 \| TLAA	X-ray repair complementing defective repair in Chinese hamster cells 6	Two-hybrid	BioGRID	16169070
YY1	DELTA \| INO80S \| NF-E1 \| UCRBP \| YIN-YANG-1	YY1 transcription factor	-	HPRD,BioGRID	12913000

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG DORSO VENTRAL AXIS FORMATION	25	21	All SZGR 2.0 genes in this pathway
KEGG NOTCH SIGNALING PATHWAY	47	35	All SZGR 2.0 genes in this pathway
KEGG PRION DISEASES	35	28	All SZGR 2.0 genes in this pathway
BIOCARTA PS1 PATHWAY	14	14	All SZGR 2.0 genes in this pathway
PID NOTCH PATHWAY	59	49	All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY	46	39	All SZGR 2.0 genes in this pathway
PID DELTA NP63 PATHWAY	47	34	All SZGR 2.0 genes in this pathway
PID HES HEY PATHWAY	48	39	All SZGR 2.0 genes in this pathway
PYEON HPV POSITIVE TUMORS UP	98	47	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN	118	79	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN	142	95	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN	229	142	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR	43	35	All SZGR 2.0 genes in this pathway
LUND SILENCED BY METHYLATION	16	12	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP	209	139	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A DN	103	71	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE DN	75	43	All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION DN	44	30	All SZGR 2.0 genes in this pathway
PARK HSC MARKERS	44	31	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM UP	84	58	All SZGR 2.0 genes in this pathway
MOREIRA RESPONSE TO TSA DN	18	16	All SZGR 2.0 genes in this pathway
SAFFORD T LYMPHOCYTE ANERGY	87	54	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER UP	92	45	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A DN	159	105	All SZGR 2.0 genes in this pathway
LU TUMOR ANGIOGENESIS UP	25	22	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN	138	92	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
BRUNEAU HEART GREAT VESSELS AND VALVULOGENESIS	8	8	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
FONTAINE FOLLICULAR THYROID ADENOMA DN	68	45	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA UP	66	38	All SZGR 2.0 genes in this pathway
FUKUSHIMA TNFSF11 TARGETS	16	14	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN	213	127	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
WANG NFKB TARGETS	25	15	All SZGR 2.0 genes in this pathway
DUAN PRDM5 TARGETS	79	52	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
WANG THOC1 TARGETS DN	20	14	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP	166	97	All SZGR 2.0 genes in this pathway
WARTERS RESPONSE TO IR SKIN	83	44	All SZGR 2.0 genes in this pathway
WARTERS IR RESPONSE 5GY	47	23	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-139	1559	1566	1A,m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-25/32/92/363/367	1602	1608	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-30-5p	1520	1526	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-34/449	180	186	m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
				hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-34b	181	187	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-34b	181	187	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-495	1588	1594	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NOTCH1