Gene Page: NRGN
Summary ?
| GeneID | 4900 |
| Symbol | NRGN |
| Synonyms | RC3|hng |
| Description | neurogranin |
| Reference | MIM:602350|HGNC:HGNC:8000|Ensembl:ENSG00000154146|HPRD:03828|Vega:OTTHUMG00000165928 |
| Gene type | protein-coding |
| Map location | 11q24 |
| Pascal p-value | 1.518E-10 |
| Sherlock p-value | 0.975 |
| Fetal beta | -2.579 |
| Support | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0265 |
Section I. Genetics and epigenetics annotation
CV:PGC128
| SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
|---|---|---|---|---|---|---|---|
| rs55661361 | chr11 | 124613957 | AG | 3.678E-12 | intronic | NRGN |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BAT1 | 0.96 | 0.91 |
| ZNF3 | 0.95 | 0.92 |
| ZSCAN21 | 0.94 | 0.90 |
| TRA2A | 0.94 | 0.94 |
| UIMC1 | 0.94 | 0.89 |
| SAAL1 | 0.94 | 0.85 |
| FAM48A | 0.94 | 0.91 |
| WTAP | 0.94 | 0.90 |
| PSMC3IP | 0.94 | 0.86 |
| ZNF586 | 0.93 | 0.87 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HLA-F | -0.72 | -0.72 |
| AIFM3 | -0.71 | -0.75 |
| PTH1R | -0.71 | -0.73 |
| FBXO2 | -0.71 | -0.68 |
| AF347015.27 | -0.71 | -0.86 |
| AF347015.31 | -0.71 | -0.85 |
| C5orf53 | -0.70 | -0.69 |
| ALDOC | -0.69 | -0.67 |
| MT-CO2 | -0.69 | -0.83 |
| AF347015.33 | -0.69 | -0.82 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005516 | calmodulin binding | TAS | 10075657 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 10075657 |
| GO:0007165 | signal transduction | TAS | 10075657 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| MISSIAGLIA REGULATED BY METHYLATION DN | 122 | 67 | All SZGR 2.0 genes in this pathway |
| TANG SENESCENCE TP53 TARGETS DN | 57 | 33 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
| HU ANGIOGENESIS UP | 21 | 16 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| TERAMOTO OPN TARGETS CLUSTER 8 | 8 | 7 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM1 | 229 | 137 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| BERTUCCI INVASIVE CARCINOMA DUCTAL VS LOBULAR UP | 25 | 17 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| GNATENKO PLATELET SIGNATURE | 48 | 28 | All SZGR 2.0 genes in this pathway |
| WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN | 24 | 15 | All SZGR 2.0 genes in this pathway |
| MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
| BROWN MYELOID CELL DEVELOPMENT DN | 129 | 86 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| LEIN LOCALIZED TO PROXIMAL DENDRITES | 37 | 26 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER T7 | 98 | 63 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
| TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| RAMPON ENRICHED LEARNING ENVIRONMENT EARLY DN | 10 | 10 | All SZGR 2.0 genes in this pathway |
| RAGHAVACHARI PLATELET SPECIFIC GENES | 70 | 46 | All SZGR 2.0 genes in this pathway |
| LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-153 | 641 | 647 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-23 | 796 | 803 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-323 | 796 | 802 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-448 | 641 | 647 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.