Gene Page: PCMT1
Summary ?
GeneID | 5110 |
Symbol | PCMT1 |
Synonyms | PIMT |
Description | protein-L-isoaspartate (D-aspartate) O-methyltransferase |
Reference | MIM:176851|HGNC:HGNC:8728|Ensembl:ENSG00000120265|HPRD:08908|Vega:OTTHUMG00000015794 |
Gene type | protein-coding |
Map location | 6q25.1 |
Pascal p-value | 0.044 |
Fetal beta | -0.973 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0211 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02043083 | 6 | 150070997 | PCMT1 | -0.039 | 0.37 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7132043 | chr12 | 80968399 | PCMT1 | 5110 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RYBP | 0.81 | 0.79 |
GALC | 0.81 | 0.86 |
LMBR1 | 0.79 | 0.81 |
PDZD8 | 0.78 | 0.82 |
ZFR | 0.77 | 0.83 |
FBXW11 | 0.77 | 0.83 |
FIG4 | 0.77 | 0.71 |
SKIL | 0.77 | 0.83 |
ATAD1 | 0.77 | 0.79 |
HS2ST1 | 0.77 | 0.78 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.59 | -0.55 |
MT-CO2 | -0.56 | -0.56 |
IL32 | -0.56 | -0.57 |
FXYD1 | -0.53 | -0.53 |
IFI27 | -0.53 | -0.53 |
AF347015.31 | -0.53 | -0.54 |
HIGD1B | -0.52 | -0.53 |
CSAG1 | -0.52 | -0.50 |
VAMP5 | -0.52 | -0.48 |
C16orf74 | -0.51 | -0.59 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004719 | protein-L-isoaspartate (D-aspartate) O-methyltransferase activity | TAS | 8074695 | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008168 | methyltransferase activity | IEA | - | |
GO:0042802 | identical protein binding | IPI | 17353931 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006464 | protein modification process | IEA | - | |
GO:0006479 | protein amino acid methylation | TAS | 3355545 | |
GO:0030091 | protein repair | TAS | 8074695 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005783 | endoplasmic reticulum | TAS | 1339271 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID WITH 7Q DELETION UP | 67 | 37 | All SZGR 2.0 genes in this pathway |
SEIDEN ONCOGENESIS BY MET | 88 | 53 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 UP | 209 | 139 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
DORSAM HOXA9 TARGETS UP | 35 | 25 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
ZHOU TNF SIGNALING 4HR | 54 | 36 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C2 | 54 | 39 | All SZGR 2.0 genes in this pathway |
VISALA AGING LYMPHOCYTE DN | 19 | 10 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
JOSEPH RESPONSE TO SODIUM BUTYRATE UP | 31 | 21 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
BHATI G2M ARREST BY 2METHOXYESTRADIOL UP | 125 | 68 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
LINSLEY MIR16 TARGETS | 206 | 127 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-15/16/195/424/497 | 735 | 741 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-182 | 813 | 820 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-194 | 151 | 157 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-330 | 809 | 815 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-495 | 149 | 155 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-96 | 814 | 820 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.