Gene Page: CRIM1
Summary ?
GeneID | 51232 |
Symbol | CRIM1 |
Synonyms | CRIM-1|S52 |
Description | cysteine rich transmembrane BMP regulator 1 (chordin-like) |
Reference | MIM:606189|HGNC:HGNC:2359|Ensembl:ENSG00000150938|HPRD:08392|Vega:OTTHUMG00000099419 |
Gene type | protein-coding |
Map location | 2p21 |
Pascal p-value | 0.024 |
eGene | Cerebellar Hemisphere |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005010 | insulin-like growth factor receptor activity | TAS | 10642437 | |
GO:0004867 | serine-type endopeptidase inhibitor activity | IEA | - | |
GO:0005520 | insulin-like growth factor binding | IEA | - | |
GO:0004857 | enzyme inhibitor activity | IEA | - | |
GO:0004197 | cysteine-type endopeptidase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 10642437 |
GO:0001558 | regulation of cell growth | IEA | - | |
GO:0006508 | proteolysis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0016021 | integral to membrane | TAS | 10642437 | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
LIU CMYB TARGETS UP | 165 | 106 | All SZGR 2.0 genes in this pathway |
LIU VMYB TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP | 85 | 54 | All SZGR 2.0 genes in this pathway |
PAPASPYRIDONOS UNSTABLE ATEROSCLEROTIC PLAQUE DN | 43 | 29 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 2HR DN | 88 | 53 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 6HR DN | 167 | 100 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES SKIN UP | 177 | 113 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
MAHADEVAN IMATINIB RESISTANCE UP | 23 | 15 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
PETRETTO CARDIAC HYPERTROPHY | 34 | 26 | All SZGR 2.0 genes in this pathway |
LIN SILENCED BY TUMOR MICROENVIRONMENT | 108 | 73 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
ROETH TERT TARGETS DN | 8 | 7 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
KANG DOXORUBICIN RESISTANCE DN | 19 | 8 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
COATES MACROPHAGE M1 VS M2 UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
OSADA ASCL1 TARGETS DN | 24 | 20 | All SZGR 2.0 genes in this pathway |
BERNARD PPAPDC1B TARGETS DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
BREDEMEYER RAG SIGNALING VIA ATM NOT VIA NFKB UP | 49 | 32 | All SZGR 2.0 genes in this pathway |
RUIZ TNC TARGETS DN | 142 | 79 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 10 | 33 | 22 | All SZGR 2.0 genes in this pathway |
VALK AML WITH EVI1 | 25 | 15 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
BILANGES SERUM SENSITIVE VIA TSC2 | 39 | 25 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
IKEDA MIR1 TARGETS UP | 53 | 39 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
NABA ECM GLYCOPROTEINS | 196 | 99 | All SZGR 2.0 genes in this pathway |
NABA CORE MATRISOME | 275 | 148 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 1238 | 1244 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-145 | 1574 | 1580 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-15/16/195/424/497 | 673 | 679 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-17-5p/20/93.mr/106/519.d | 1671 | 1677 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-18 | 1020 | 1026 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-181 | 1189 | 1196 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-21 | 1592 | 1598 | m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-216 | 1203 | 1209 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
miR-223 | 193 | 199 | m8 | hsa-miR-223 | UGUCAGUUUGUCAAAUACCCC |
miR-28 | 1524 | 1530 | m8 | hsa-miR-28brain | AAGGAGCUCACAGUCUAUUGAG |
miR-326 | 388 | 394 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-331 | 833 | 839 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
miR-335 | 2270 | 2276 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
miR-369-3p | 1857 | 1863 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU | ||||
miR-374 | 962 | 968 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG | ||||
miR-410 | 964 | 970 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-495 | 2010 | 2016 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU | ||||
miR-505 | 1186 | 1192 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC | ||||
miR-544 | 160 | 166 | m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
miR-9 | 216 | 222 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-93.hd/291-3p/294/295/302/372/373/520 | 1670 | 1676 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.