SZGR2

Summary ?

GeneID	596
Symbol	BCL2
Synonyms	Bcl-2\|PPP1R50
Description	B-cell CLL/lymphoma 2
Reference	MIM:151430\|HGNC:HGNC:990\|HPRD:01045\|
Gene type	protein-coding
Map location	18q21.3
Pascal p-value	0.025
Sherlock p-value	0.276
Fetal beta	1.981
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1729

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg22152050	18	60987904	BCL2	4.796E-4	-0.235	0.046	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs6879593	chr5	75253310	BCL2	596	0.05	trans
rs2655880	chr12	60797980	BCL2	596	0.16	trans
rs10784054	chr12	60822443	BCL2	596	0.16	trans
rs2036975	chr13	30181116	BCL2	596	0.11	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZFYVE28	0.90	0.87
ZBTB7A	0.88	0.90
CBX7	0.88	0.93
PACSIN1	0.88	0.89
SYNM	0.88	0.84
CNTNAP1	0.88	0.82
MAP1A	0.88	0.81
SIRPA	0.87	0.88
IQSEC3	0.87	0.76
COBL	0.86	0.86

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C9orf46	-0.67	-0.80
EXOSC8	-0.65	-0.75
DYNLT1	-0.64	-0.82
BCL7C	-0.64	-0.73
TUBB2B	-0.64	-0.63
TRAF4	-0.64	-0.72
RPS8	-0.62	-0.80
AC079354.7	-0.62	-0.68
RPS18	-0.62	-0.77
KIAA1949	-0.62	-0.51

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0002020	protease binding	IDA		10620603
GO:0042803	protein homodimerization activity	IDA		9111042
GO:0046982	protein heterodimerization activity	IPI		9111042
GO:0051434	BH3 domain binding	IPI		9111042
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043524	negative regulation of neuron apoptosis	IEA	neuron (GO term level: 9)	-
GO:0001836	release of cytochrome c from mitochondria	NAS		9027314
GO:0008219	cell death	IDA		8949945
GO:0008284	positive regulation of cell proliferation	IEA		-
GO:0008633	activation of pro-apoptotic gene products	EXP		15231831
GO:0010039	response to iron ion	IDA		11264898
GO:0034097	response to cytokine stimulus	IDA		9184696
GO:0009636	response to toxin	IDA		16307838
GO:0007565	female pregnancy	NAS		11530860
GO:0006959	humoral immune response	TAS		1908951
GO:0006916	anti-apoptosis	IDA		9027314 \|10506221 \|10620603 \|11684014
GO:0009314	response to radiation	NAS		15799693
GO:0042100	B cell proliferation	IDA		1373874
GO:0031069	hair follicle morphogenesis	IEA		-
GO:0042493	response to drug	IDA		8949945
GO:0043496	regulation of protein homodimerization activity	IDA		9111042
GO:0043497	regulation of protein heterodimerization activity	IDA		9111042
GO:0051607	defense response to virus	IDA		10620603
GO:0043473	pigmentation	IEA		-
GO:0032848	negative regulation of cellular pH reduction	IDA		10506221
GO:0035094	response to nicotine	IDA		12421819
GO:0046902	regulation of mitochondrial membrane permeability	ISS		9843949
GO:0045069	regulation of viral genome replication	IEA		-
GO:0051881	regulation of mitochondrial membrane potential	ISS		9843949
GO:0051902	negative regulation of mitochondrial depolarization	TAS		9027314
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	IEA		-
GO:0005789	endoplasmic reticulum membrane	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IDA		11530860
GO:0005739	mitochondrion	IDA		9027314
GO:0005741	mitochondrial outer membrane	EXP		10198631 \|11463392 \|12624108
GO:0005741	mitochondrial outer membrane	IDA		9027314
GO:0005741	mitochondrial outer membrane	TAS		1453000
GO:0005783	endoplasmic reticulum	IEA		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0031965	nuclear membrane	IDA		1502141

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATP2A2	ATP2B \| DAR \| DD \| DKFZp686P0211 \| FLJ20293 \| FLJ38063 \| MGC45367 \| SERCA2	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	-	HPRD	9788433
AVEN	PDCD12	apoptosis, caspase activation inhibitor	Affinity Capture-Western Two-hybrid	BioGRID	10949025
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Bcl-2 interacts with Bad.	BIND	9130713
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	-	HPRD,BioGRID	7834748
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Bad interacts with Bcl-2.	BIND	15694340
BAD	BBC2 \| BCL2L8	BCL2-associated agonist of cell death	Bad interacts with Bcl-2.	BIND	15574335
BAG1	RAP46	BCL2-associated athanogene	-	HPRD,BioGRID	9305631
BAG3	BAG-3 \| BIS \| CAIR-1 \| MGC104307	BCL2-associated athanogene 3	Bcl-2 interacts with BAG-3. This interaction was modelled on a demonstrated interaction between Bcl-2 from an unspecified species and human BAG-3.	BIND	11527400
BAG3	BAG-3 \| BIS \| CAIR-1 \| MGC104307	BCL2-associated athanogene 3	-	HPRD	11513873
BAG4	BAG-4 \| SODD	BCL2-associated athanogene 4	-	HPRD,BioGRID	11527400
BAG4	BAG-4 \| SODD	BCL2-associated athanogene 4	Bcl-2 interacts with BAG-4. This interaction was modelled on a demonstrated interaction between Bcl-2 from an unspecified species and human BAG-4.	BIND	11527400
BAK1	BAK \| BAK-LIKE \| BCL2L7 \| CDN1 \| MGC117255 \| MGC3887	BCL2-antagonist/killer 1	-	HPRD,BioGRID	11728179
BAX	BCL2L4	BCL2-associated X protein	-	HPRD,BioGRID	8358790
BAX	BCL2L4	BCL2-associated X protein	Bax interacts with Bcl-2.	BIND	15574335
BAX	BCL2L4	BCL2-associated X protein	-	HPRD	8358790\|9111042
BAX	BCL2L4	BCL2-associated X protein	Bcl-2 interacts with Bax.	BIND	9130713
BBC3	JFY1 \| PUMA	BCL2 binding component 3	PUMA-beta interacts with Bcl-2.	BIND	11463392
BBC3	JFY1 \| PUMA	BCL2 binding component 3	-	HPRD,BioGRID	11463392
BBC3	JFY1 \| PUMA	BCL2 binding component 3	PUMA interacts with Bcl-2.	BIND	15574335
BBC3	JFY1 \| PUMA	BCL2 binding component 3	PUMA-alpha interacts with Bcl-2.	BIND	11463392
BBC3	JFY1 \| PUMA	BCL2 binding component 3	Puma interacts with Bcl-2.	BIND	15694340
BCAP31	6C6-AG \| BAP31 \| CDM \| DXS1357E	B-cell receptor-associated protein 31	-	HPRD,BioGRID	9334338
BCL2	Bcl-2	B-cell CLL/lymphoma 2	-	HPRD	9111042 \|15302859
BCL2L1	BCL-XL/S \| BCL2L \| BCLX \| Bcl-X \| DKFZp781P2092 \| bcl-xL \| bcl-xS	BCL2-like 1	-	HPRD	11583631
BCL2L1	BCL-XL/S \| BCL2L \| BCLX \| Bcl-X \| DKFZp781P2092 \| bcl-xL \| bcl-xS	BCL2-like 1	Affinity Capture-Western Protein-peptide	BioGRID	12137781 \|14980220
BCL2L10	BCL-B \| Boo \| Diva \| MGC129810 \| MGC129811	BCL2-like 10 (apoptosis facilitator)	-	HPRD,BioGRID	11278245
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	-	HPRD,BioGRID	9430630
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	Bim interacts with Bcl-2.	BIND	15694340
BCL2L14	BCLG	BCL2-like 14 (apoptosis facilitator)	-	HPRD	11054413
BCLAF1	BTF \| KIAA0164 \| bK211L9.1	BCL2-associated transcription factor 1	-	HPRD	10330179
BECN1	ATG6 \| VPS30 \| beclin1	beclin 1, autophagy related	-	HPRD,BioGRID	9765397
BFAR	BAR \| RNF47	bifunctional apoptosis regulator	-	HPRD	10716992
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Bid interacts with Bcl-2.	BIND	15694340
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Protein-peptide	BioGRID	15520201 \|15694340
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	Bid interacts with Bcl-2.	BIND	15574335
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	-	HPRD	9727491
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	-	HPRD	9525867 \|12853473\|12853473
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	Bcl-2 interacts with Bik.	BIND	9130713
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	Bik interacts with Bcl-2.	BIND	15694340
BIK	BIP1 \| BP4 \| NBK	BCL2-interacting killer (apoptosis-inducing)	-	HPRD,BioGRID	12853473
BLK	MGC10442	B lymphoid tyrosine kinase	-	HPRD,BioGRID	9525867
BMF	FLJ00065	Bcl2 modifying factor	Bmf interacts with Bcl-2. This interaction was modelled on a demonstrated interaction between mouse Bmf and human Bcl-2.	BIND	15694340
BMF	FLJ00065	Bcl2 modifying factor	-	HPRD,BioGRID	11546872
BNIP1	NIP1 \| SEC20 \| TRG-8	BCL2/adenovirus E1B 19kDa interacting protein 1	-	HPRD,BioGRID	10217402
BNIP2	BNIP-2 \| NIP2	BCL2/adenovirus E1B 19kDa interacting protein 2	-	HPRD,BioGRID	7954800 \|12901880
BNIP3	NIP3	BCL2/adenovirus E1B 19kDa interacting protein 3	-	HPRD,BioGRID	10625696
BNIP3L	BNIP3a \| NIX	BCL2/adenovirus E1B 19kDa interacting protein 3-like	-	HPRD,BioGRID	9973195\|10467396
BNIPL	BNIP-S \| BNIPL-1 \| BNIPL-2 \| BNIPL1 \| BNIPL2 \| PP753	BCL2/adenovirus E1B 19kD interacting protein like	-	HPRD,BioGRID	12901880
BNIPL	BNIP-S \| BNIPL-1 \| BNIPL-2 \| BNIPL1 \| BNIPL2 \| PP753	BCL2/adenovirus E1B 19kD interacting protein like	BNIPL-2 interacts with Bcl-2.	BIND	12901880
CAPN2	CANP2 \| CANPL2 \| CANPml \| FLJ39928 \| mCANP	calpain 2, (m/II) large subunit	Biochemical Activity Reconstituted Complex	BioGRID	12000759
CASP2	CASP-2 \| ICH-1L \| ICH-1L/1S \| ICH1 \| NEDD2	caspase 2, apoptosis-related cysteine peptidase	Phenotypic Suppression	BioGRID	11832478
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	-	HPRD,BioGRID	11948397
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	-	HPRD,BioGRID	11406564
CDC2	CDC28A \| CDK1 \| DKFZp686L20222 \| MGC111195	cell division cycle 2, G1 to S and G2 to M	Affinity Capture-Western	BioGRID	11326318 \|11774038
CDK2	p33(CDK2)	cyclin-dependent kinase 2	-	HPRD	15619620
CYCS	CYC \| HCS	cytochrome c, somatic	-	HPRD	10622714
DYNLL1	DLC1 \| DLC8 \| DNCL1 \| DNCLC1 \| LC8 \| LC8a \| MGC126137 \| MGC126138 \| PIN \| hdlc1	dynein, light chain, LC8-type 1	Affinity Capture-Western	BioGRID	10198631
EPHB2	CAPB \| DRT \| EPHT3 \| ERK \| Hek5 \| MGC87492 \| PCBC \| Tyro5	EPH receptor B2	Biochemical Activity	BioGRID	15225643
FKBP8	FKBP38 \| FKBPr38	FK506 binding protein 8, 38kDa	-	HPRD,BioGRID	12510191
HRAS	C-BAS/HAS \| C-H-RAS \| C-HA-RAS1 \| CTLO \| H-RASIDX \| HAMSV \| HRAS1 \| K-RAS \| N-RAS \| RASH1	v-Ha-ras Harvey rat sarcoma viral oncogene homolog	-	HPRD	10490827
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	-	HPRD,BioGRID	9130713 \|10075695
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	Hrk interacts with Bcl-2.	BIND	9130713
HRK	DP5 \| HARAKIRI	harakiri, BCL2 interacting protein (contains only BH3 domain)	Hrk interacts with Bcl-2.	BIND	15694340
HSPA1A	FLJ54303 \| FLJ54370 \| FLJ54392 \| FLJ54408 \| FLJ75127 \| HSP70-1 \| HSP70-1A \| HSP70I \| HSP72 \| HSPA1 \| HSPA1B	heat shock 70kDa protein 1A	-	HPRD,BioGRID	10354271
IRS1	HIRS-1	insulin receptor substrate 1	Affinity Capture-Western	BioGRID	10679027
IRS2	-	insulin receptor substrate 2	Affinity Capture-Western	BioGRID	10679027
ITM2B	ABRI \| BRI \| BRI2 \| BRICD2B \| E25B \| E3-16 \| FBD	integral membrane protein 2B	-	HPRD,BioGRID	12082633
ITPR1	INSP3R1 \| IP3R \| IP3R1 \| SCA15 \| SCA16	inositol 1,4,5-triphosphate receptor, type 1	Affinity Capture-Western	BioGRID	15613488
KRAS	C-K-RAS \| K-RAS2A \| K-RAS2B \| K-RAS4A \| K-RAS4B \| KI-RAS \| KRAS1 \| KRAS2 \| NS3 \| RASK2	v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog	-	HPRD	10490827
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	-	HPRD	15225643
MAPK11	P38B \| P38BETA2 \| PRKM11 \| SAPK2 \| SAPK2B \| p38-2 \| p38Beta	mitogen-activated protein kinase 11	-	HPRD	11495898
MOAP1	MAP-1 \| PNMA4	modulator of apoptosis 1	-	HPRD,BioGRID	11060313
MOAP1	MAP-1 \| PNMA4	modulator of apoptosis 1	MAP-1 interacts with Bcl-2.	BIND	11060313
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	Affinity Capture-Western Co-localization	BioGRID	15210690
NR4A1	GFRP1 \| HMR \| MGC9485 \| N10 \| NAK-1 \| NGFIB \| NP10 \| NUR77 \| TR3	nuclear receptor subfamily 4, group A, member 1	-	HPRD,BioGRID	14980220
NRAS	ALPS4 \| N-ras \| NRAS1	neuroblastoma RAS viral (v-ras) oncogene homolog	-	HPRD	10490827
P53AIP1	-	p53-regulated apoptosis-inducing protein 1	-	HPRD,BioGRID	12019168
PARP1	ADPRT \| ADPRT1 \| PARP \| PARP-1 \| PPOL \| pADPRT-1	poly (ADP-ribose) polymerase 1	-	HPRD,BioGRID	11790116
PIN1	DOD \| UBL5	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	-	HPRD	11988841
PIN1	DOD \| UBL5	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	Affinity Capture-Western	BioGRID	11326318
PKMYT1	DKFZp547K1610 \| FLJ20093 \| MYT1	protein kinase, membrane associated tyrosine/threonine 1	-	HPRD	11326318
PMAIP1	APR \| NOXA	phorbol-12-myristate-13-acetate-induced protein 1	-	HPRD,BioGRID	10807576
PPP1CA	MGC15877 \| MGC1674 \| PP-1A \| PPP1A	protein phosphatase 1, catalytic subunit, alpha isoform	-	HPRD	11390485
PPP2CA	PP2Ac \| PP2CA \| RP-C	protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform	-	HPRD,BioGRID	9852076
PPP2R4	MGC2184 \| PP2A \| PR53 \| PTPA	protein phosphatase 2A activator, regulatory subunit 4	Biochemical Activity	BioGRID	15225643
PPP2R5A	B56A \| MGC131915 \| PR61A	protein phosphatase 2, regulatory subunit B', alpha isoform	-	HPRD,BioGRID	11929874
PPP3CA	CALN \| CALNA \| CALNA1 \| CCN1 \| CNA1 \| PPP2B	protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform	-	HPRD,BioGRID	7593193 \|9109491
PSEN1	AD3 \| FAD \| PS1 \| S182	presenilin 1	-	HPRD,BioGRID	10521466
RAD9A	RAD9	RAD9 homolog A (S. pombe)	-	HPRD,BioGRID	10620799
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	8910675 \|8929532
RHEB	MGC111559 \| RHEB2	Ras homolog enriched in brain	Bcl-2 interacts with Rheb.	BIND	9130713
RRAS	-	related RAS viral (r-ras) oncogene homolog	-	HPRD,BioGRID	8232588
RTN4	ASY \| NI220/250 \| NOGO \| NOGO-A \| NOGOC \| NSP \| NSP-CL \| Nbla00271 \| Nbla10545 \| Nogo-B \| Nogo-C \| RTN-X \| RTN4-A \| RTN4-B1 \| RTN4-B2 \| RTN4-C	reticulon 4	RTN-XS interacts with Bcl-2.	BIND	11126360
RTN4	ASY \| NI220/250 \| NOGO \| NOGO-A \| NOGOC \| NSP \| NSP-CL \| Nbla00271 \| Nbla10545 \| Nogo-B \| Nogo-C \| RTN-X \| RTN4-A \| RTN4-B1 \| RTN4-B2 \| RTN4-C	reticulon 4	-	HPRD,BioGRID	11126360
SERPINB8	CAP2 \| PI8	serpin peptidase inhibitor, clade B (ovalbumin), member 8	Affinity Capture-Western	BioGRID	15231068
SF1	D11S636 \| ZFM1 \| ZNF162	splicing factor 1	-	HPRD,BioGRID	8668206
SMN1	BCD541 \| SMA \| SMA1 \| SMA2 \| SMA3 \| SMA4 \| SMA@ \| SMN \| SMNT \| T-BCD541	survival of motor neuron 1, telomeric	-	HPRD,BioGRID	9389483
SOD1	ALS \| ALS1 \| IPOA \| SOD \| homodimer	superoxide dismutase 1, soluble	-	HPRD,BioGRID	15233914
SPNS1	FLJ38358 \| HSpin1 \| LAT \| PP2030 \| SPIN1 \| SPINL \| nrs	spinster homolog 1 (Drosophila)	-	HPRD,BioGRID	12815463
TMBIM6	BAXI1 \| BI-1 \| TEGT	transmembrane BAX inhibitor motif containing 6	-	HPRD,BioGRID	9660918
TOMM20	KIAA0016 \| MAS20 \| MGC117367 \| MOM19 \| TOM20	translocase of outer mitochondrial membrane 20 homolog (yeast)	-	HPRD,BioGRID	9119086
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD	12667443
TP53BP2	53BP2 \| ASPP2 \| BBP \| PPP1R13A \| p53BP2	tumor protein p53 binding protein, 2	-	HPRD,BioGRID	8668206

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG APOPTOSIS	88	62	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS	53	43	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
BIOCARTA CHEMICAL PATHWAY	22	15	All SZGR 2.0 genes in this pathway
BIOCARTA CERAMIDE PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA IL2RB PATHWAY	38	26	All SZGR 2.0 genes in this pathway
BIOCARTA IL7 PATHWAY	17	14	All SZGR 2.0 genes in this pathway
BIOCARTA DEATH PATHWAY	33	24	All SZGR 2.0 genes in this pathway
BIOCARTA KERATINOCYTE PATHWAY	46	38	All SZGR 2.0 genes in this pathway
BIOCARTA P53 PATHWAY	16	13	All SZGR 2.0 genes in this pathway
BIOCARTA BAD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
BIOCARTA MITOCHONDRIA PATHWAY	21	15	All SZGR 2.0 genes in this pathway
BIOCARTA HSP27 PATHWAY	15	11	All SZGR 2.0 genes in this pathway
BIOCARTA TEL PATHWAY	18	15	All SZGR 2.0 genes in this pathway
SIG IL4RECEPTOR IN B LYPHOCYTES	27	23	All SZGR 2.0 genes in this pathway
ST GA13 PATHWAY	37	32	All SZGR 2.0 genes in this pathway
SA FAS SIGNALING	9	5	All SZGR 2.0 genes in this pathway
SIG BCR SIGNALING PATHWAY	46	38	All SZGR 2.0 genes in this pathway
SA PROGRAMMED CELL DEATH	12	9	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
PID IL2 1PATHWAY	55	43	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID CERAMIDE PATHWAY	48	37	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID RXR VDR PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID ATF2 PATHWAY	59	43	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PID HIV NEF PATHWAY	35	26	All SZGR 2.0 genes in this pathway
PID CASPASE PATHWAY	52	39	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME INNATE IMMUNE SYSTEM	279	178	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATION OF BH3 ONLY PROTEINS	17	12	All SZGR 2.0 genes in this pathway
REACTOME INFLAMMASOMES	17	12	All SZGR 2.0 genes in this pathway
REACTOME NUCLEOTIDE BINDING DOMAIN LEUCINE RICH REPEAT CONTAINING RECEPTOR NLR SIGNALING PATHWAYS	46	33	All SZGR 2.0 genes in this pathway
REACTOME INTRINSIC PATHWAY FOR APOPTOSIS	30	21	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA DN	52	30	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER DN	481	290	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 UP	112	72	All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY DN	362	238	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN	118	79	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN	537	339	All SZGR 2.0 genes in this pathway
HAHTOLA SEZARY SYNDROM DN	42	26	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
NUNODA RESPONSE TO DASATINIB IMATINIB UP	29	20	All SZGR 2.0 genes in this pathway
MARKS HDAC TARGETS DN	15	11	All SZGR 2.0 genes in this pathway
BAKER HEMATOPOESIS STAT1 TARGETS	10	9	All SZGR 2.0 genes in this pathway
BAKER HEMATOPOIESIS STAT3 TARGETS	16	12	All SZGR 2.0 genes in this pathway
BAKER HEMATOPOESIS STAT5 TARGETS	7	7	All SZGR 2.0 genes in this pathway
GALLUZZI PERMEABILIZE MITOCHONDRIA	43	31	All SZGR 2.0 genes in this pathway
DUTTA APOPTOSIS VIA NFKB	33	25	All SZGR 2.0 genes in this pathway
GALLUZZI PREVENT MITOCHONDIAL PERMEABILIZATION	22	16	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
HONRADO BREAST CANCER BRCA1 VS BRCA2	18	12	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS DN	97	51	All SZGR 2.0 genes in this pathway
SHANK TAL1 TARGETS DN	10	6	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER	88	64	All SZGR 2.0 genes in this pathway
MANTOVANI NFKB TARGETS UP	43	33	All SZGR 2.0 genes in this pathway
MANTOVANI VIRAL GPCR SIGNALING UP	86	54	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A	100	63	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
GEORGES CELL CYCLE MIR192 TARGETS	62	46	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 3	28	23	All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE DN	76	52	All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 DN	64	47	All SZGR 2.0 genes in this pathway
GOLDRATH HOMEOSTATIC PROLIFERATION	171	102	All SZGR 2.0 genes in this pathway
RADAEVA RESPONSE TO IFNA1 UP	52	40	All SZGR 2.0 genes in this pathway
POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC DN	59	35	All SZGR 2.0 genes in this pathway
TENEDINI MEGAKARYOCYTE MARKERS	66	48	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
FERRANDO LYL1 NEIGHBORS	15	12	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
YAO HOXA10 TARGETS VIA PROGESTERONE UP	79	58	All SZGR 2.0 genes in this pathway
NUMATA CSF3 SIGNALING VIA STAT3	22	17	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING UP	101	76	All SZGR 2.0 genes in this pathway
BRUNO HEMATOPOIESIS	66	48	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
BRACHAT RESPONSE TO METHOTREXATE DN	27	19	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KIM GASTRIC CANCER CHEMOSENSITIVITY	103	64	All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP	262	186	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP	244	151	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR DN	91	64	All SZGR 2.0 genes in this pathway
ZHENG RESPONSE TO ARSENITE UP	18	14	All SZGR 2.0 genes in this pathway
ZHU CMV ALL DN	128	93	All SZGR 2.0 genes in this pathway
BRACHAT RESPONSE TO CAMPTOTHECIN DN	46	31	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE DN	373	196	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P2	79	55	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN	37	29	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN	281	179	All SZGR 2.0 genes in this pathway
CLAUS PGR POSITIVE MENINGIOMA DN	12	10	All SZGR 2.0 genes in this pathway
WONG MITOCHONDRIA GENE MODULE	217	122	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING UP	115	80	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER MARKERS	19	16	All SZGR 2.0 genes in this pathway
ENGELMANN CANCER PROGENITORS UP	48	31	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
MATZUK EMBRYONIC GERM CELL	19	16	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE	72	55	All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1	91	75	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
MOOTHA HUMAN MITODB 6 2002	429	260	All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA	447	277	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS UP	40	25	All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS DN	74	50	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE DN	75	61	All SZGR 2.0 genes in this pathway
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE UP	43	34	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN ACTIVATED B LYMPHOCYTE	81	66	All SZGR 2.0 genes in this pathway
ZHAN LATE DIFFERENTIATION GENES UP	33	24	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL UP	73	49	All SZGR 2.0 genes in this pathway
WOO LIVER CANCER RECURRENCE UP	105	75	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
ONO FOXP3 TARGETS DN	42	23	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2	86	50	All SZGR 2.0 genes in this pathway
NIELSEN MALIGNAT FIBROUS HISTIOCYTOMA DN	18	11	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway
ABDELMOHSEN ELAVL4 TARGETS	16	13	All SZGR 2.0 genes in this pathway
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE	151	86	All SZGR 2.0 genes in this pathway
BOSCO TH1 CYTOTOXIC MODULE	114	62	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR DN	55	35	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-143	1819	1825	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-149	2398	2404	1A	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-15/16/195/424/497	2529	2536	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-153	26	32	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-181	1752	1758	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-182	205	211	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-182	205	211	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-204/211	209	216	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	209	216	1A,m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-205	3920	3926	m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-21	720	726	1A	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	720	726	1A	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-217	2568	2574	1A	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-30-5p	2487	2493	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-34/449	203	209	1A	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-365	1711	1717	1A	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU
miR-384	704	710	1A	hsa-miR-384	AUUCCUAGAAAUUGUUCAUA
miR-448	58	64	m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-448	58	64	m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-493-5p	3746	3752	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-503	2530	2536	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG
miR-96	205	211	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BCL2