Gene Page: SLC6A4
Summary ?
GeneID | 6532 |
Symbol | SLC6A4 |
Synonyms | 5-HTT|5-HTTLPR|5HTT|HTT|OCD1|SERT|SERT1|hSERT |
Description | solute carrier family 6 member 4 |
Reference | MIM:182138|HGNC:HGNC:11050|Ensembl:ENSG00000108576|HPRD:01640|Vega:OTTHUMG00000132751 |
Gene type | protein-coding |
Map location | 17q11.2 |
Pascal p-value | 0.038 |
Support | NEUROTRANSMITTER METABOLISM SEROTONIN |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
ADT:Sun_2012 | Systematic Investigation of Antipsychotic Drugs and Their Targets | A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes. | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias,schizotypal | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0015222 | serotonin transmembrane transporter activity | TAS | serotonin, Neurotransmitter (GO term level: 7) | 7681602 |
GO:0005335 | serotonin:sodium symporter activity | IEA | serotonin, Neurotransmitter (GO term level: 10) | - |
GO:0005515 | protein binding | IPI | 11343649 | |
GO:0015293 | symporter activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006837 | serotonin transport | TAS | serotonin, Neurotransmitter (GO term level: 5) | 7681602 |
GO:0001504 | neurotransmitter uptake | TAS | neuron, Cholinergic, Synap, Neurotransmitter, Glial (GO term level: 8) | 7681602 |
GO:0015844 | monoamine transport | IDA | 16024787 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 7681602 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DIERICK SEROTONIN FUNCTION GENES | 6 | 6 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON | 133 | 78 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME2 AND H3K27ME3 | 59 | 35 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
SUMI HNF4A TARGETS | 34 | 14 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 436 | 442 | 1A | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-15/16/195/424/497 | 504 | 510 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.