SZGR2

Summary ?

GeneID	6597
Symbol	SMARCA4
Synonyms	BAF190\|BAF190A\|BRG1\|MRD16\|RTPS2\|SNF2\|SNF2L4\|SNF2LB\|SWI2\|hSNF2b
Description	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Reference	MIM:603254\|HGNC:HGNC:11100\|Ensembl:ENSG00000127616\|HPRD:04459\|Vega:OTTHUMG00000169272
Gene type	protein-coding
Map location	19p13.2
Pascal p-value	0.598
Sherlock p-value	0.021
Fetal beta	0.751
DMG	2 (# studies)
Support	CompositeSet Darnell FMRP targets Ascano FMRP targets Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0172

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg12411068	19	11072235	SMARCA4		-0.048	0.27	DMG:Nishioka_2013
cg25397562	19	11616711	SMARCA4	0.001	3.654		DMG:vanEijk_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TPRKB	0.89	0.81
CETN3	0.85	0.76
RPL35A	0.84	0.83
CCDC58	0.81	0.68
PSMA2	0.81	0.73
SNRPE	0.81	0.66
TBCA	0.81	0.73
RPL23	0.80	0.82
RPL24	0.80	0.76
TPT1	0.79	0.77

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZBTB47	-0.54	-0.63
TMEM184B	-0.53	-0.68
PK4P	-0.53	-0.64
BCL2L2	-0.52	-0.69
ATP10A	-0.52	-0.65
VASN	-0.51	-0.65
GAS2L1	-0.50	-0.57
TNS1	-0.50	-0.70
SYNM	-0.50	-0.67
PEAR1	-0.50	-0.64

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003677	DNA binding	IEA		-
GO:0003682	chromatin binding	IEA		-
GO:0003700	transcription factor activity	TAS		8208605
GO:0003713	transcription coactivator activity	TAS		8208605
GO:0005524	ATP binding	IEA		-
GO:0004386	helicase activity	IEA		-
GO:0004386	helicase activity	TAS		8208605
GO:0016787	hydrolase activity	IEA		-
GO:0008134	transcription factor binding	IEA		-
GO:0042802	identical protein binding	IPI		12917342
GO:0047485	protein N-terminus binding	IPI		12917342
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007403	glial cell fate determination	IEA	Glial (GO term level: 10)	-
GO:0030902	hindbrain development	IEA	Brain (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0001835	blastocyst hatching	IEA		-
GO:0001832	blastocyst growth	IEA		-
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		8208605
GO:0006350	transcription	IEA		-
GO:0006346	methylation-dependent chromatin silencing	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000792	heterochromatin	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005634	nucleus	TAS		8232556
GO:0005654	nucleoplasm	TAS		8208605

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTB	PS1TP5BP1	actin, beta	-	HPRD,BioGRID	9845365
ACTL6A	ACTL6 \| Arp4 \| BAF53A \| INO80K \| MGC5382	actin-like 6A	-	HPRD,BioGRID	9845365
AHR	-	aryl hydrocarbon receptor	-	HPRD,BioGRID	11805098
ALB	DKFZp779N1935 \| PRO0883 \| PRO0903 \| PRO1341	albumin	Brg-1 interactis with the Albumin gene.	BIND	15616580
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Affinity Capture-Western	BioGRID	14966121
ARID1A	B120 \| BAF250 \| BAF250a \| BM029 \| C1orf4 \| P270 \| SMARCF1	AT rich interactive domain 1A (SWI-like)	Affinity Capture-Western Co-purification	BioGRID	8895581 \|9845365
ARID1B	6A3-5 \| BAF250b \| BRIGHT \| DAN15 \| ELD/OSA1 \| KIAA1235 \| p250R	AT rich interactive domain 1B (SWI1-like)	ELD/OSA1 interacts with BRG1.	BIND	11988099
ARID1B	6A3-5 \| BAF250b \| BRIGHT \| DAN15 \| ELD/OSA1 \| KIAA1235 \| p250R	AT rich interactive domain 1B (SWI1-like)	-	HPRD,BioGRID	11988099 \|12200431
BAZ1B	WBSCR10 \| WBSCR9 \| WSTF	bromodomain adjacent to zinc finger domain, 1B	-	HPRD	12837248
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	10943845
BRWD1	C21orf107 \| FLJ43918 \| N143 \| WDR9	bromodomain and WD repeat domain containing 1	-	HPRD	12889071
CBX5	HP1 \| HP1A	chromobox homolog 5 (HP1 alpha homolog, Drosophila)	-	HPRD,BioGRID	12411497
CCNE1	CCNE	cyclin E1	-	HPRD,BioGRID	9891079
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	BRG1 interacts with p21 promoter.	BIND	15780937
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD	10619021
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	Phenotypic Enhancement	BioGRID	11003650
CSF1	MCSF \| MGC31930	colony stimulating factor 1 (macrophage)	BRG1 interacts with CSF1 promoter.	BIND	15780937
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD,BioGRID	11532957
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	9099865
ETS2	ETS2IT1	v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)	ETS2 (Ets-2) interacts with SMARCA4 (Brg-1). This interaction was modeled on a demonstrated interaction between ETS2 from an unspecified species and SMARCA4 from an unspecified species.	BIND	12637547
FANCA	FA \| FA-H \| FA1 \| FAA \| FACA \| FAH \| FANCH \| MGC75158	Fanconi anemia, complementation group A	-	HPRD,BioGRID	11726552
GATA1	ERYF1 \| GF-1 \| GF1 \| NFE1	GATA binding protein 1 (globin transcription factor 1)	Reconstituted Complex	BioGRID	11018012
GRM2	GLUR2 \| GPRC1B \| MGLUR2 \| mGlu2	glutamate receptor, metabotropic 2	BRG1 interacts with mGluR2 promoter.	BIND	15035981
H3F3A	H3.3A \| H3F3 \| MGC87782 \| MGC87783	H3 histone, family 3A	H3F3A (Histone 3) interacts with SMARCA4 (BRG-1).	BIND	15616580
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Co-purification	BioGRID	11238380
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD	10944117
HNF1A	HNF1 \| LFB1 \| MODY3 \| TCF1	HNF1 homeobox A	Brg-1 interacts with the HNF-1 gene.	BIND	15616580
HNF4A	FLJ39654 \| HNF4 \| HNF4a7 \| HNF4a8 \| HNF4a9 \| MODY \| MODY1 \| NR2A1 \| NR2A21 \| TCF \| TCF14	hepatocyte nuclear factor 4, alpha	Brg-1 interacts with the HNF-4 gene.	BIND	15616580
HSF1	HSTF1	heat shock transcription factor 1	Affinity Capture-Western in vitro	BioGRID	8856972 \|11486022
HSF1	HSTF1	heat shock transcription factor 1	-	HPRD	8856972 \|9222609 \|11486022
HSP90B1	ECGP \| GP96 \| GRP94 \| TRA1	heat shock protein 90kDa beta (Grp94), member 1	Affinity Capture-Western	BioGRID	11726552
ING1	p24ING1c \| p33 \| p33ING1 \| p33ING1b \| p47 \| p47ING1a	inhibitor of growth family, member 1	Affinity Capture-MS Affinity Capture-Western	BioGRID	11784859
KLF1	EKLF	Kruppel-like factor 1 (erythroid)	Reconstituted Complex	BioGRID	11018012
MED17	CRSP6 \| CRSP77 \| DRIP80 \| FLJ10812 \| TRAP80	mediator complex subunit 17	Co-purification	BioGRID	12154023
MPHOSPH6	MPP \| MPP-6 \| MPP6	M-phase phosphoprotein 6	-	HPRD	15231747
MPP6	PALS2 \| VAM-1 \| VAM1 \| p55T	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	-	HPRD,BioGRID	15231747
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	Affinity Capture-MS Affinity Capture-Western	BioGRID	11839798 \|17353931
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	Phenotypic Enhancement	BioGRID	11003650
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	Co-purification	BioGRID	11013263
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	Co-fractionation	BioGRID	10944117
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	Affinity Capture-Western Reconstituted Complex	BioGRID	10688647 \|12917342
PABPN1	OPMD \| PAB2 \| PABP2	poly(A) binding protein, nuclear 1	Two-hybrid	BioGRID	11371506
PHB	PHB1	prohibitin	-	HPRD,BioGRID	12065415
PHB	PHB1	prohibitin	Prohibitin interacts with Brg-1	BIND	12065415
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Affinity Capture-Western Co-purification in vitro	BioGRID	8895581 \|9443979 \|9845365 \|11238380
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	-	HPRD	9443979 \|12154023
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	7923370
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	Co-purification	BioGRID	11238380
RELB	I-REL \| IREL	v-rel reticuloendotheliosis viral oncogene homolog B	Affinity Capture-MS	BioGRID	14743216
SIN3A	DKFZp434K2235 \| FLJ90319 \| KIAA0700	SIN3 homolog A, transcription regulator (yeast)	Affinity Capture-Western Co-purification Reconstituted Complex	BioGRID	11238380 \|11784859
SMARCB1	BAF47 \| INI1 \| RDT \| SNF5 \| SNF5L1 \| Sfh1p \| Snr1 \| hSNFS	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	-	HPRD,BioGRID	8895581
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	Affinity Capture-Western Co-purification	BioGRID	8895581 \|9845365 \|11238380 \|11726552
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	-	HPRD	9891079
SMARCC2	BAF170 \| CRACC2 \| Rsc8	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	Affinity Capture-Western Co-purification	BioGRID	8895581 \|9845365 \|11726552
SMARCD1	BAF60A \| CRACD1 \| Rsc6p	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1	Affinity Capture-Western	BioGRID	12917342
SMARCE1	BAF57	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	Affinity Capture-Western Co-purification	BioGRID	8895581 \|9845365
SP1	-	Sp1 transcription factor	Reconstituted Complex	BioGRID	11018012
SS18	MGC116875 \| SSXT \| SYT \| SYT-SSX1 \| SYT-SSX2	synovial sarcoma translocation, chromosome 18	-	HPRD	11734557\|14603256
STAT2	ISGF-3 \| MGC59816 \| P113 \| STAT113	signal transducer and activator of transcription 2, 113kDa	-	HPRD,BioGRID	12244326
STK11	LKB1 \| PJS	serine/threonine kinase 11	-	HPRD,BioGRID	11445556
STMN2	SCG10 \| SCGN10 \| SGC10	stathmin-like 2	BRG1 interacts with SCG10 promoter.	BIND	15035981
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Affinity Capture-Western Co-fractionation Reconstituted Complex	BioGRID	11950834
VDR	NR1I1	vitamin D (1,25- dihydroxyvitamin D3) receptor	Affinity Capture-Western	BioGRID	12837248

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID REG GR PATHWAY	82	60	All SZGR 2.0 genes in this pathway
PID ERB GENOMIC PATHWAY	15	8	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID RB 1PATHWAY	65	46	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA PROGENITOR DN	66	42	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP	95	64	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP	204	140	All SZGR 2.0 genes in this pathway
HUMMEL BURKITTS LYMPHOMA UP	43	27	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP	265	158	All SZGR 2.0 genes in this pathway
MAYBURD RESPONSE TO L663536 UP	29	18	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
NADERI BREAST CANCER PROGNOSIS UP	50	26	All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID WITH 7Q DELETION UP	67	37	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN	137	97	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
MATTIOLI MGUS VS PCL	116	62	All SZGR 2.0 genes in this pathway
MATTIOLI MULTIPLE MYELOMA SUBGROUPS	16	7	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
MORI LARGE PRE BII LYMPHOCYTE UP	86	49	All SZGR 2.0 genes in this pathway
MORI IMMATURE B LYMPHOCYTE DN	90	55	All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE DN	75	43	All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP	110	69	All SZGR 2.0 genes in this pathway
GOLUB ALL VS AML UP	24	20	All SZGR 2.0 genes in this pathway
CHANG POU5F1 TARGETS UP	15	10	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
GILDEA METASTASIS	30	14	All SZGR 2.0 genes in this pathway
MUNSHI MULTIPLE MYELOMA DN	11	6	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI DN	172	107	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
RHODES CANCER META SIGNATURE	64	47	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS UP	56	35	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN	86	66	All SZGR 2.0 genes in this pathway
MEDINA SMARCA4 TARGETS	44	29	All SZGR 2.0 genes in this pathway
MCCLUNG COCAIN REWARD 4WK	75	47	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN	141	92	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
HOWLIN CITED1 TARGETS 2 UP	17	10	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE DN	50	33	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A5	70	32	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
FOURNIER ACINAR DEVELOPMENT LATE 2	277	172	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP	605	377	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14	143	86	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS DN	87	66	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN UP	90	58	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
BILANGES SERUM SENSITIVE VIA TSC2	39	25	All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL UP	146	75	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	7	14	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-101	358	364	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-139	313	319	m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-144	358	364	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-155	204	211	1A,m8	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-199	417	423	1A	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	417	423	1A	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-324-5p	328	334	1A	hsa-miR-324-5p	CGCAUCCCCUAGGGCAUUGGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SMARCA4