Gene Page: VCL
Summary ?
GeneID | 7414 |
Symbol | VCL |
Synonyms | CMD1W|CMH15|HEL114|MV|MVCL |
Description | vinculin |
Reference | MIM:193065|HGNC:HGNC:12665|Ensembl:ENSG00000035403|HPRD:01900|Vega:OTTHUMG00000018498 |
Gene type | protein-coding |
Map location | 10q22.2 |
Pascal p-value | 0.3 |
Sherlock p-value | 3.539E-5 |
Fetal beta | 0.282 |
eGene | Myers' cis & trans Meta |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.169 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10128354 | chr10 | 75470044 | VCL | 7414 | 0.12 | cis | ||
rs7901055 | chr10 | 76415028 | VCL | 7414 | 0.14 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/VCL_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IDA | 7816144 | |
GO:0005198 | structural molecule activity | IEA | - | |
GO:0016491 | oxidoreductase activity | ISS | - | |
GO:0045294 | alpha-catenin binding | IPI | 9700171 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007155 | cell adhesion | TAS | 15501673 | |
GO:0006928 | cell motion | TAS | 16130169 | |
GO:0030336 | negative regulation of cell migration | TAS | 15494027 | |
GO:0043297 | apical junction assembly | IMP | 9700171 | |
GO:0030032 | lamellipodium biogenesis | ISS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005925 | focal adhesion | ISS | - | |
GO:0005916 | fascia adherens | IEA | - | |
GO:0005912 | adherens junction | ISS | - | |
GO:0005911 | cell-cell junction | ISS | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0015629 | actin cytoskeleton | IEA | - | |
GO:0030055 | cell-substrate junction | NAS | 2116004 | |
GO:0043234 | protein complex | IDA | 9700171 | |
GO:0043034 | costamere | ISS | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABI2 | ABI-2 | ABI2B | AIP-1 | AblBP3 | SSH3BP2 | argBPIA | argBPIB | abl interactor 2 | Two-hybrid | BioGRID | 16189514 |
ACTA1 | ACTA | ASMA | CFTD | CFTD1 | CFTDM | MPFD | NEM1 | NEM2 | NEM3 | actin, alpha 1, skeletal muscle | - | HPRD | 7816144 |
BCAR1 | CAS | CAS1 | CASS1 | CRKAS | P130Cas | breast cancer anti-estrogen resistance 1 | Affinity Capture-Western | BioGRID | 11577104 |
C19orf57 | MGC11271 | MGC149720 | chromosome 19 open reading frame 57 | Two-hybrid | BioGRID | 16189514 |
CDH1 | Arc-1 | CD324 | CDHE | ECAD | LCAM | UVO | cadherin 1, type 1, E-cadherin (epithelial) | Affinity Capture-Western | BioGRID | 9405455 |9535896 |
CLTC | CHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034 | clathrin, heavy chain (Hc) | - | HPRD,BioGRID | 8276759 |
CORO2B | CLIPINC | KIAA0925 | coronin, actin binding protein, 2B | - | HPRD,BioGRID | 10224093 |
CTNNA1 | CAP102 | FLJ36832 | catenin (cadherin-associated protein), alpha 1, 102kDa | - | HPRD,BioGRID | 9700171 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | Affinity Capture-Western | BioGRID | 9405455 |
GSN | DKFZp313L0718 | gelsolin (amyloidosis, Finnish type) | - | HPRD,BioGRID | 11577104 |
NRAP | - | nebulin-related anchoring protein | - | HPRD,BioGRID | 10320340 |
PSME1 | IFI5111 | MGC8628 | PA28A | PA28alpha | REGalpha | proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) | Two-hybrid | BioGRID | 16169070 |
PXN | FLJ16691 | paxillin | - | HPRD,BioGRID | 9054445 |
PXN | FLJ16691 | paxillin | - | HPRD | 7525621 |7534286|9054445 |
RAVER1 | KIAA1978 | ribonucleoprotein, PTB-binding 1 | - | HPRD | 11724819 |
SELE | CD62E | ELAM | ELAM1 | ESEL | LECAM2 | selectin E | - | HPRD | 8609175 |
SORBS1 | CAP | DKFZp451C066 | DKFZp586P1422 | FLAF2 | FLJ12406 | KIAA1296 | R85FL | SH3D5 | SH3P12 | SORB1 | sorbin and SH3 domain containing 1 | - | HPRD,BioGRID | 10085297 |
SORBS2 | ARGBP2 | FLJ93447 | KIAA0777 | PRO0618 | sorbin and SH3 domain containing 2 | - | HPRD,BioGRID | 10521485 |
TGFB1I1 | ARA55 | HIC-5 | HIC5 | TSC-5 | transforming growth factor beta 1 induced transcript 1 | Reconstituted Complex | BioGRID | 9858471 |
TRIP6 | MGC10556 | MGC10558 | MGC29959 | MGC3837 | MGC4423 | OIP1 | ZRP-1 | thyroid hormone receptor interactor 6 | Two-hybrid | BioGRID | 16189514 |
VASP | - | vasodilator-stimulated phosphoprotein | - | HPRD,BioGRID | 10882740 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG ADHERENS JUNCTION | 75 | 53 | All SZGR 2.0 genes in this pathway |
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
BIOCARTA CELL2CELL PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
BIOCARTA INTEGRIN PATHWAY | 38 | 29 | All SZGR 2.0 genes in this pathway |
BIOCARTA RHO PATHWAY | 32 | 23 | All SZGR 2.0 genes in this pathway |
PID RHOA PATHWAY | 45 | 33 | All SZGR 2.0 genes in this pathway |
PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN STABILIZATION PATHWAY | 42 | 34 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
PID FAK PATHWAY | 59 | 45 | All SZGR 2.0 genes in this pathway |
REACTOME RESPONSE TO ELEVATED PLATELET CYTOSOLIC CA2 | 89 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME MUSCLE CONTRACTION | 48 | 24 | All SZGR 2.0 genes in this pathway |
REACTOME SMOOTH MUSCLE CONTRACTION | 25 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS UP | 194 | 112 | All SZGR 2.0 genes in this pathway |
BERENJENO ROCK SIGNALING NOT VIA RHOA DN | 48 | 34 | All SZGR 2.0 genes in this pathway |
BARIS THYROID CANCER DN | 59 | 45 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
TOMLINS PROSTATE CANCER DN | 40 | 33 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
GUENTHER GROWTH SPHERICAL VS ADHERENT DN | 26 | 19 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
LU IL4 SIGNALING | 94 | 56 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
HASLINGER B CLL WITH CHROMOSOME 12 TRISOMY | 24 | 12 | All SZGR 2.0 genes in this pathway |
TAVOR CEBPA TARGETS UP | 48 | 36 | All SZGR 2.0 genes in this pathway |
YAGI AML FAB MARKERS | 191 | 131 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 10 | 30 | 17 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
WU HBX TARGETS 3 UP | 18 | 11 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
CHEN LVAD SUPPORT OF FAILING HEART UP | 103 | 69 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 8 | 86 | 57 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND ENDOTHELIUM | 66 | 47 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST | 132 | 93 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
IZADPANAH STEM CELL ADIPOSE VS BONE DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
CHUNG BLISTER CYTOTOXICITY DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
DAVIES MULTIPLE MYELOMA VS MGUS DN | 28 | 18 | All SZGR 2.0 genes in this pathway |
BOHN PRIMARY IMMUNODEFICIENCY SYNDROM DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
GOLDRATH ANTIGEN RESPONSE | 346 | 192 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
TAVAZOIE METASTASIS | 108 | 68 | All SZGR 2.0 genes in this pathway |
ZHAN EARLY DIFFERENTIATION GENES DN | 42 | 29 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 12 | 30 | 20 | All SZGR 2.0 genes in this pathway |
FONTAINE PAPILLARY THYROID CARCINOMA UP | 66 | 38 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 | 143 | 86 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE M G1 | 148 | 95 | All SZGR 2.0 genes in this pathway |
RAGHAVACHARI PLATELET SPECIFIC GENES | 70 | 46 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
BAKKER FOXO3 TARGETS UP | 61 | 41 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
CHEMELLO SOLEUS VS EDL MYOFIBERS DN | 19 | 10 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 954 | 961 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-182 | 1678 | 1684 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-29 | 792 | 798 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-34/449 | 882 | 888 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-485-3p | 1667 | 1673 | 1A | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-9 | 1680 | 1686 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 1678 | 1684 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.