SZGR2

Summary ?

GeneID	8204
Symbol	NRIP1
Synonyms	RIP140
Description	nuclear receptor interacting protein 1
Reference	MIM:602490\|HGNC:HGNC:8001\|Ensembl:ENSG00000180530\|HPRD:03927\|Vega:OTTHUMG00000074323
Gene type	protein-coding
Map location	21q11.2
Pascal p-value	4.662E-4
Sherlock p-value	0.53
Fetal beta	-0.064
eGene	Putamen basal ganglia
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Girard_2011	Whole Exome Sequencing analysis	The data set included 15 DNMs found from the exomes of 14 schizophrenia probands and their parents.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
NRIP1	chr21	16338349	T	G	NM_003489	p.722K>T	missense			Schizophrenia	DNM:Girard_2011

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2822746	21	15899364	NRIP1	ENSG00000180530.5	1.06941E-6	0.01	537957	gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IEA	Neurotransmitter (GO term level: 4)	-
GO:0003713	transcription coactivator activity	IDA		7641693 \|10364267 \|11518808
GO:0003713	transcription coactivator activity	NAS		15572661
GO:0003714	transcription corepressor activity	IDA		10364267
GO:0042826	histone deacetylase binding	IEA		-
GO:0035257	nuclear hormone receptor binding	IPI		11518808
GO:0030331	estrogen receptor binding	IPI		7641693
GO:0035259	glucocorticoid receptor binding	IPI		10364267 \|11266503 \|12773562
GO:0050681	androgen receptor binding	NAS		15572661
GO:0046965	retinoid X receptor binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	IDA		10364267
GO:0001543	ovarian follicle rupture	IEA		-
GO:0006350	transcription	IEA		-
GO:0019915	sequestering of lipid	IEA		-
GO:0030728	ovulation	IEA		-
GO:0030521	androgen receptor signaling pathway	NAS		15572661
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IDA		7641693 \|10364267
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000118	histone deacetylase complex	IEA		-
GO:0005634	nucleus	IDA		7641693 \|11266503 \|12773562

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AHR	-	aryl hydrocarbon receptor	-	HPRD,BioGRID	10428779
CCDC85B	DIPA	coiled-coil domain containing 85B	Two-hybrid	BioGRID	16189514
CEP70	BITE \| FLJ13036	centrosomal protein 70kDa	Two-hybrid	BioGRID	16189514
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	Reconstituted Complex	BioGRID	15060175
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	-	HPRD	11509661
CTBP2	-	C-terminal binding protein 2	Reconstituted Complex Two-hybrid	BioGRID	15060175 \|16189514
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	ESR1 (ER-alpha) interacts with NRIP1 (RIP140). This interaction was modelled on a demonstrated interaction between human ESR1 and mouse NRIP1.	BIND	9774463
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	ER interacts with NRIP-1 enhancer.	BIND	16009131
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	7641693
FOXA1	HNF3A \| MGC33105 \| TCF3A	forkhead box A1	FOXA1 interacts with NRIP-1 enhancer.	BIND	16009131
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD	11006275\|11285237
HDAC5	FLJ90614 \| HD5 \| NY-CO-9	histone deacetylase 5	Co-localization Reconstituted Complex	BioGRID	15060175
HDAC9	DKFZp779K1053 \| HD7 \| HDAC \| HDAC7 \| HDAC7B \| HDAC9B \| HDAC9FL \| HDRP \| KIAA0744 \| MITR	histone deacetylase 9	Reconstituted Complex	BioGRID	15060175
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	12554755
KAT2B	CAF \| P \| P/CAF \| PCAF	K(lysine) acetyltransferase 2B	-	HPRD	14581481
LDOC1	BCUR1 \| Mar7 \| Mart7	leucine zipper, down-regulated in cancer 1	Two-hybrid	BioGRID	16189514
MAP3K7	TAK1 \| TGF1a	mitogen-activated protein kinase kinase kinase 7	-	HPRD	9556573
NR0B1	AHC \| AHCH \| AHX \| DAX-1 \| DAX1 \| DSS \| GTD \| HHG \| NROB1	nuclear receptor subfamily 0, group B, member 1	Reconstituted Complex Two-hybrid	BioGRID	11459805
NR1H3	LXR-a \| LXRA \| RLD-1	nuclear receptor subfamily 1, group H, member 3	-	HPRD	10022764
NR2C1	TR2	nuclear receptor subfamily 2, group C, member 1	-	HPRD	9774688
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	Affinity Capture-Western Reconstituted Complex	BioGRID	10364267 \|11266503 \|12773562
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD	10364267 \|12773562
NR5A1	AD4BP \| ELP \| FTZ1 \| FTZF1 \| SF-1 \| SF1	nuclear receptor subfamily 5, group A, member 1	-	HPRD,BioGRID	11459805 \|12782406
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Pol II interacts with NRIP-1 enhancer.	BIND	16009131
PPARA	MGC2237 \| MGC2452 \| NR1C1 \| PPAR \| hPPAR	peroxisome proliferator-activated receptor alpha	-	HPRD,BioGRID	9626662 \|10022764
PPARG	NR1C3 \| PPARG1 \| PPARG2 \| PPARgamma	peroxisome proliferator-activated receptor gamma	-	HPRD,BioGRID	9626662
RARA	NR1B1 \| RAR	retinoic acid receptor, alpha	Affinity Capture-Western Reconstituted Complex	BioGRID	8887632 \|12549917 \|14581481
RARA	NR1B1 \| RAR	retinoic acid receptor, alpha	-	HPRD	12403842 \|12549917
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	-	HPRD,BioGRID	8887632
RXRB	DAUDI6 \| H-2RIIBP \| MGC1831 \| NR2B2 \| RCoR-1	retinoid X receptor, beta	-	HPRD	12403842 \|12549917
RXRB	DAUDI6 \| H-2RIIBP \| MGC1831 \| NR2B2 \| RCoR-1	retinoid X receptor, beta	Reconstituted Complex	BioGRID	9626662
TEX11	TGC1 \| TSGA3	testis expressed 11	Two-hybrid	BioGRID	16189514
THRA	AR7 \| EAR7 \| ERB-T-1 \| ERBA \| ERBA1 \| MGC000261 \| MGC43240 \| NR1A1 \| THRA1 \| THRA2 \| c-ERBA-1	thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)	Reconstituted Complex	BioGRID	9626662
TNFRSF14	ATAR \| HVEA \| HVEM \| LIGHTR \| TR2	tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)	-	HPRD	9774688
TRAF2	MGC:45012 \| TRAP \| TRAP3	TNF receptor-associated factor 2	Two-hybrid	BioGRID	16189514
YWHAH	YWHA1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide	-	HPRD	11266503
YWHAQ	14-3-3 \| 1C5 \| HS1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide	Co-localization Phenotypic Suppression Reconstituted Complex	BioGRID	11266503

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA CARM ER PATHWAY	35	27	All SZGR 2.0 genes in this pathway
BIOCARTA PPARA PATHWAY	58	43	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY	65	37	All SZGR 2.0 genes in this pathway
PID RETINOIC ACID PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY	44	29	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL DN	60	39	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP	157	104	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP	146	99	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP	316	190	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT DN	95	57	All SZGR 2.0 genes in this pathway
GRAHAM NORMAL QUIESCENT VS NORMAL DIVIDING UP	66	47	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK DN	39	27	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN	137	97	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP	197	135	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
MCBRYAN TERMINAL END BUD DN	7	6	All SZGR 2.0 genes in this pathway
MARTIN INTERACT WITH HDAC	44	31	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX4 DN	32	22	All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL UP	37	28	All SZGR 2.0 genes in this pathway
BECKER TAMOXIFEN RESISTANCE UP	50	36	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH MUTATED VH GENES	18	14	All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN	24	15	All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL	50	35	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP	87	67	All SZGR 2.0 genes in this pathway
BROWN MYELOID CELL DEVELOPMENT DN	129	86	All SZGR 2.0 genes in this pathway
ROETH TERT TARGETS UP	14	11	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA MS UP	48	32	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF TROGLITAZONE DN	42	24	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C2	54	39	All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF DN	84	50	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5	126	78	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D2	41	30	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
GEORGANTAS HSC MARKERS	71	47	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP	280	183	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4	94	69	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN T LYMPHOCYTE DN	37	29	All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP	125	89	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
MASSARWEH RESPONSE TO ESTRADIOL	61	47	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN	85	58	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN	108	68	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
MATZUK OVULATION	14	10	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C CLUSTER DN	32	21	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C DN	59	39	All SZGR 2.0 genes in this pathway
FERRARI RESPONSE TO FENRETINIDE UP	22	16	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 12	30	20	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS UP	66	43	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 UP	80	54	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TROGLITAZONE DN	19	14	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP	139	93	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
CERIBELLI GENES INACTIVE AND BOUND BY NFY	45	27	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	2969	2975	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	2969	2975	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-125/351	2238	2244	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	2238	2244	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-128	244	250	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	244	250	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-143	1308	1314	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-186	622	628	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-192/215	2234	2240	m8	hsa-miR-192	CUGACCUAUGAAUUGACAGCC
miR-192/215	2234	2240	m8	hsa-miR-215	AUGACCUAUGAAUUGACAGAC
miR-193	2039	2045	m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	2039	2045	m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-194	2726	2732	1A	hsa-miR-194	UGUAACAGCAACUCCAUGUGGA
miR-200bc/429	3060	3066	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-208	3022	3028	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-214	2967	2973	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-219	2076	2082	m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-25/32/92/363/367	1201	1207	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-26	1842	1849	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1842	1849	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-27	244	250	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	244	250	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	3292	3299	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
				hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-324-3p	3445	3451	1A	hsa-miR-324-3p	CCACUGCCCCAGGUGCUGCUGG
miR-328	1385	1391	m8	hsa-miR-328^brain	CUGGCCCUCUCUGCCCUUCCGU
miR-33	2812	2818	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	2812	2818	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-377	3397	3403	1A	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-378	1312	1318	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-380-5p	3151	3158	1A,m8	hsa-miR-380-5p	UGGUUGACCAUAGAACAUGCGC
miR-380-5p	3151	3158	1A,m8	hsa-miR-563	AGGUUGACAUACGUUUCCC
miR-448	149	155	m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-488	1296	1302	m8	hsa-miR-488	CCCAGAUAAUGGCACUCUCAA
miR-490	1769	1776	1A,m8	hsa-miR-490	CAACCUGGAGGACUCCAUGCUG
miR-496	2763	2769	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-499	3022	3028	1A	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NRIP1