Gene Page: NRP2
Summary ?
GeneID | 8828 |
Symbol | NRP2 |
Synonyms | NP2|NPN2|PRO2714|VEGF165R2 |
Description | neuropilin 2 |
Reference | MIM:602070|HGNC:HGNC:8005|Ensembl:ENSG00000118257|HPRD:03643|Vega:OTTHUMG00000132893 |
Gene type | protein-coding |
Map location | 2q33.3 |
Pascal p-value | 0.77 |
Fetal beta | 1.194 |
DMG | 1 (# studies) |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg18371506 | 2 | 206547237 | NRP2 | 3.65E-9 | -0.03 | 2.34E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
UBA1 | 0.95 | 0.95 |
USP19 | 0.94 | 0.95 |
DHX30 | 0.94 | 0.94 |
ZFYVE1 | 0.94 | 0.94 |
XPO6 | 0.93 | 0.94 |
TNPO2 | 0.93 | 0.95 |
EFTUD2 | 0.93 | 0.95 |
AMBRA1 | 0.93 | 0.95 |
RIC8A | 0.93 | 0.95 |
FAM40A | 0.93 | 0.96 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.82 | -0.87 |
MT-CO2 | -0.81 | -0.87 |
AF347015.27 | -0.81 | -0.87 |
AF347015.8 | -0.80 | -0.87 |
AF347015.21 | -0.79 | -0.92 |
AF347015.33 | -0.79 | -0.84 |
MT-CYB | -0.78 | -0.84 |
AF347015.15 | -0.76 | -0.83 |
AF347015.2 | -0.75 | -0.83 |
FXYD1 | -0.75 | -0.81 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005021 | vascular endothelial growth factor receptor activity | NAS | 11112349 | |
GO:0005021 | vascular endothelial growth factor receptor activity | TAS | 9331348 | |
GO:0004872 | receptor activity | TAS | 9288754 | |
GO:0017154 | semaphorin receptor activity | IEA | - | |
GO:0017154 | semaphorin receptor activity | NAS | 11112349 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007411 | axon guidance | TAS | axon (GO term level: 13) | 9288754 |
GO:0007399 | nervous system development | IEA | neurite (GO term level: 5) | - |
GO:0001755 | neural crest cell migration | IEA | - | |
GO:0001525 | angiogenesis | NAS | 11112349 | |
GO:0007155 | cell adhesion | IEA | - | |
GO:0007155 | cell adhesion | NAS | 11112349 | |
GO:0007507 | heart development | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0050919 | negative chemotaxis | IEA | - | |
GO:0045454 | cell redox homeostasis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005624 | membrane fraction | TAS | 9288754 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0016021 | integral to membrane | NAS | 11112349 | |
GO:0005886 | plasma membrane | EXP | 11278319 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID VEGF VEGFR PATHWAY | 10 | 6 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 PATHWAY | 26 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME VEGF LIGAND RECEPTOR INTERACTIONS | 10 | 6 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D DN | 143 | 83 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER HIGH RECURRENCE | 49 | 31 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
NIELSEN LIPOSARCOMA DN | 19 | 8 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
HENDRICKS SMARCA4 TARGETS DN | 53 | 34 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA RADIATION | 81 | 59 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR DN | 191 | 123 | All SZGR 2.0 genes in this pathway |
LABBE TARGETS OF TGFB1 AND WNT3A DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
BRUECKNER TARGETS OF MIRLET7A3 DN | 78 | 49 | All SZGR 2.0 genes in this pathway |
LIN TUMOR ESCAPE FROM IMMUNE ATTACK | 18 | 12 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA2 UP | 87 | 50 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 2 UP | 54 | 31 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 3 UP | 170 | 97 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 4 UP | 112 | 64 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 5 UP | 12 | 8 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 6 UP | 140 | 81 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 7 UP | 118 | 68 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
JUBAN TARGETS OF SPI1 AND FLI1 UP | 115 | 73 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA VIA KDM3A | 53 | 34 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 31 | 37 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-10 | 2774 | 2780 | m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-124/506 | 1429 | 1435 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 2967 | 2973 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-141/200a | 1921 | 1927 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-146 | 1995 | 2001 | m8 | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
miR-15/16/195/424/497 | 1798 | 1804 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-183 | 87 | 93 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-200bc/429 | 2695 | 2701 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-27 | 2967 | 2973 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-328 | 2768 | 2774 | m8 | hsa-miR-328brain | CUGGCCCUCUCUGCCCUUCCGU |
miR-331 | 645 | 652 | 1A,m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
miR-381 | 3023 | 3029 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-496 | 2981 | 2987 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-504 | 666 | 672 | 1A | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
miR-543 | 1880 | 1886 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.