SZGR2

Summary ?

GeneID	2932
Symbol	GSK3B
Synonyms	-
Description	glycogen synthase kinase 3 beta
Reference	MIM:605004\|HGNC:HGNC:4617\|Ensembl:ENSG00000082701\|HPRD:05418\|Vega:OTTHUMG00000133765
Gene type	protein-coding
Map location	3q13.3
Pascal p-value	0.866
Sherlock p-value	0.682
Fetal beta	0.554
eGene	Myers' cis & trans
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	2	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.4135

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs7715946	chr5	146925366	GSK3B	2932	0.14	trans
rs16930362	chr10	74890320	GSK3B	2932	0.09	trans
rs16915029	chr10	75001994	GSK3B	2932	0.14	trans
rs16930466	chr10	75007587	GSK3B	2932	0.16	trans
rs16930573	chr10	75167645	GSK3B	2932	0.16	trans
rs12571454	chr10	75208954	GSK3B	2932	0.05	trans
rs1324669	chr13	107872446	GSK3B	2932	0.06	trans
rs16958358	chr17	55502410	GSK3B	2932	0.09	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLC2A4	0.68	0.60
SELENBP1	0.66	0.68
FAM107A	0.65	0.64
ACADS	0.65	0.68
ALDH1L1	0.65	0.64
CD40	0.65	0.58
CRYL1	0.64	0.73
ALDH2	0.63	0.51
FAH	0.62	0.67
C10orf54	0.62	0.59

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
STRBP	-0.46	-0.54
ARIH1	-0.46	-0.56
PURG	-0.45	-0.51
TMEM169	-0.45	-0.54
GFPT1	-0.45	-0.53
PAPD5	-0.45	-0.53
LEO1	-0.45	-0.52
RTF1	-0.45	-0.50
FAM32A	-0.44	-0.52
NOVA2	-0.44	-0.52

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0050321	tau-protein kinase activity	IEA	Brain (GO term level: 7)	-
GO:0000166	nucleotide binding	IEA		-
GO:0002039	p53 binding	IDA		14744935
GO:0004696	glycogen synthase kinase 3 activity	IDA		14744935
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0051059	NF-kappaB binding	IPI		15465828
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007242	intracellular signaling cascade	IDA		14749367
GO:0005977	glycogen metabolic process	TAS		7980435
GO:0006983	ER overload response	IDA		14744935
GO:0043066	negative regulation of apoptosis	IDA		14744935
GO:0018105	peptidyl-serine phosphorylation	IDA		11104755 \|14744935
GO:0046827	positive regulation of protein export from nucleus	IDA		14744935
GO:0060070	Wnt receptor signaling pathway through beta-catenin	IC		9601641
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		8524413 \|11955436 \|12000790 \|12820959 \|15327769 \|16753179
GO:0005634	nucleus	IDA		14744935
GO:0005737	cytoplasm	IDA		14744935
GO:0030877	beta-catenin destruction complex	IDA		9601641 \|16188939

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACLY	ACL \| ATPCL \| CLATP	ATP citrate lyase	Affinity Capture-MS	BioGRID	17353931
AKAP11	AKAP220 \| DKFZp781I12161 \| FLJ11304 \| KIAA0629 \| PRKA11	A kinase (PRKA) anchor protein 11	-	HPRD,BioGRID	12147701
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	AKT1 interacts with and phosphorylates GSK3B. This interaction was modelled on a demonstrated interaction between human AKT1 and GSK3B from an unspecified species.	BIND	15688030
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	Reconstituted Complex	BioGRID	16009706
AKT2	PKBB \| PKBBETA \| PRKBB \| RAC-BETA	v-akt murine thymoma viral oncogene homolog 2	-	HPRD,BioGRID	12434148
APC	BTPS2 \| DP2 \| DP2.5 \| DP3 \| GS	adenomatous polyposis coli	Affinity Capture-Western	BioGRID	11251183
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Affinity Capture-Western Reconstituted Complex	BioGRID	15178691
AXIN1	AXIN \| MGC52315	axin 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9734785 \|12511557
AXIN2	AXIL \| DKFZp781B0869 \| MGC10366 \| MGC126582	axin 2	-	HPRD,BioGRID	10966653
BCL3	BCL4 \| D19S37	B-cell CLL/lymphoma 3	GSK3-beta interacts with and phosphorylates BCL-3.	BIND	15469820
BXDC1	FLJ21087 \| RPF2 \| bA397G5.4	brix domain containing 1	Affinity Capture-MS	BioGRID	17353931
C14orf129	GSKIP \| HSPC210 \| MGC4945	chromosome 14 open reading frame 129	Affinity Capture-MS	BioGRID	17353931
CCNE1	CCNE	cyclin E1	Biochemical Activity	BioGRID	14536078
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	GSK3B (GSK3-Beta) interacts with and phosphorylates CTNNB1 (Beta-catenin).	BIND	15829978
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western Biochemical Activity	BioGRID	10330181 \|11251183
DDX20	DKFZp434H052 \| DP103 \| GEMIN3	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	Affinity Capture-MS	BioGRID	17353931
DHX36	DDX36 \| G4R1 \| KIAA1488 \| MLEL1 \| RHAU	DEAH (Asp-Glu-Ala-His) box polypeptide 36	Affinity Capture-MS	BioGRID	17353931
DNM1L	DLP1 \| DRP1 \| DVLP \| DYMPLE \| DYNIV-11 \| FLJ41912 \| HDYNIV \| VPS1	dynamin 1-like	-	HPRD,BioGRID	9731200
DVL1	DVL \| MGC54245	dishevelled, dsh homolog 1 (Drosophila)	-	HPRD	10428961
EWSR1	EWS	Ewing sarcoma breakpoint region 1	Affinity Capture-MS	BioGRID	17353931
FRAT1	FLJ97193	frequently rearranged in advanced T-cell lymphomas	-	HPRD	12095675
FRAT2	MGC10562	frequently rearranged in advanced T-cell lymphomas 2	-	HPRD	11738041
GEMIN4	DKFZp434B131 \| DKFZp434D174 \| HC56 \| HCAP1 \| HHRF-1 \| p97	gem (nuclear organelle) associated protein 4	Affinity Capture-MS	BioGRID	17353931
GSK3B	-	glycogen synthase kinase 3 beta	-	HPRD	14529625
IGF2BP1	CRD-BP \| CRDBP \| IMP-1 \| IMP1 \| VICKZ1 \| ZBP1	insulin-like growth factor 2 mRNA binding protein 1	Affinity Capture-MS	BioGRID	17353931
ILK	DKFZp686F1765 \| P59	integrin-linked kinase	-	HPRD	9736715
MAPT	DDPAC \| FLJ31424 \| FTDP-17 \| MAPTL \| MGC138549 \| MSTD \| MTBT1 \| MTBT2 \| PPND \| TAU	microtubule-associated protein tau	GSK3beta phosphorylates Ftau.This interaction was modelled on a demonstrated interaction between rabbit GSK3beta and human Ftau.	BIND	14636947
MUC1	CD227 \| EMA \| H23AG \| MAM6 \| PEM \| PEMT \| PUM	mucin 1, cell surface associated	-	HPRD,BioGRID	9819408
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	SRC-3 interacts with and is phosphorylated by GSK3-beta.	BIND	15383283
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	-	HPRD,BioGRID	11425860
NIN	KIAA1565	ninein (GSK3B interacting protein)	-	HPRD,BioGRID	11004522
NOTCH1	TAN1 \| hN1	Notch homolog 1, translocation-associated (Drosophila)	-	HPRD,BioGRID	12123574
NOTCH2	AGS2 \| hN2	Notch homolog 2 (Drosophila)	-	HPRD,BioGRID	12794074
OGT	FLJ23071 \| HRNT1 \| MGC22921 \| O-GLCNAC	O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)	-	HPRD	10753899
PPP1CA	MGC15877 \| MGC1674 \| PP-1A \| PPP1A	protein phosphatase 1, catalytic subunit, alpha isoform	Affinity Capture-Western	BioGRID	12147701
PPYR1	MGC116897 \| NPY4-R \| NPY4R \| PP1 \| Y4	pancreatic polypeptide receptor 1	-	HPRD	12147701
PRKAR2A	MGC3606 \| PKR2 \| PRKAR2	protein kinase, cAMP-dependent, regulatory, type II, alpha	Affinity Capture-Western	BioGRID	12147701
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	Biochemical Activity	BioGRID	1324914
PRKCB	MGC41878 \| PKC-beta \| PKCB \| PRKCB1 \| PRKCB2	protein kinase C, beta	-	HPRD	1324914
PRKCD	MAY1 \| MGC49908 \| PKCD \| nPKC-delta	protein kinase C, delta	PKC-delta interacts with and phosphorylates GSK3-beta. This interaction was modeled on a demonstrated interaction between human PKC-delta and rabbit GSK3-beta.	BIND	15824731
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD,BioGRID	11809746
PTPN1	PTP1B	protein tyrosine phosphatase, non-receptor type 1	-	HPRD,BioGRID	7514173
SF3B1	PRP10 \| PRPF10 \| SAP155 \| SF3b155	splicing factor 3b, subunit 1, 155kDa	Affinity Capture-MS	BioGRID	17353931
SGK3	CISK \| DKFZp781N0293 \| SGK2 \| SGKL	serum/glucocorticoid regulated kinase family, member 3	-	HPRD,BioGRID	12054501
SMN2	BCD541 \| C-BCD541 \| FLJ76644 \| MGC20996 \| MGC5208 \| SMNC	survival of motor neuron 2, centromeric	Affinity Capture-MS	BioGRID	17353931
SMYD2	HSKM-B \| KMT3C \| MGC119305 \| ZMYND14	SET and MYND domain containing 2	Affinity Capture-MS	BioGRID	17353931
SNAI1	SLUGH2 \| SNA \| SNAH \| dJ710H13.1	snail homolog 1 (Drosophila)	Snail interacts with GSK-3beta.	BIND	15448698
SNRNP70	RNPU1Z \| RPU1 \| SNRP70 \| U170K \| U1AP \| U1RNP	small nuclear ribonucleoprotein 70kDa (U1)	Affinity Capture-MS	BioGRID	17353931
STRAP	MAWD \| PT-WD \| UNRIP	serine/threonine kinase receptor associated protein	Affinity Capture-MS	BioGRID	17353931
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	p53 interacts with GSK3-beta.	BIND	12048243
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	12048243
TPPP	TPPP/p25 \| TPPP1 \| p24 \| p25 \| p25alpha	tubulin polymerization promoting protein	-	HPRD	11781156
TSC1	KIAA0243 \| LAM \| MGC86987 \| TSC	tuberous sclerosis 1	Affinity Capture-Western	BioGRID	12511557
TSC2	FLJ43106 \| LAM \| TSC4	tuberous sclerosis 2	Affinity Capture-Western Biochemical Activity	BioGRID	12511557 \|16959574
UPF3A	HUPF3A \| RENT3A \| UPF3	UPF3 regulator of nonsense transcripts homolog A (yeast)	-	HPRD,BioGRID	15231747
XPO6	EXP6 \| FLJ22519 \| KIAA0370 \| RANBP20	exportin 6	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG HEDGEHOG SIGNALING PATHWAY	56	42	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG B CELL RECEPTOR SIGNALING PATHWAY	75	56	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY	137	103	All SZGR 2.0 genes in this pathway
KEGG MELANOGENESIS	102	80	All SZGR 2.0 genes in this pathway
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG BASAL CELL CARCINOMA	55	44	All SZGR 2.0 genes in this pathway
BIOCARTA ALK PATHWAY	37	29	All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY	28	21	All SZGR 2.0 genes in this pathway
BIOCARTA P35ALZHEIMERS PATHWAY	11	9	All SZGR 2.0 genes in this pathway
BIOCARTA GSK3 PATHWAY	27	26	All SZGR 2.0 genes in this pathway
BIOCARTA PITX2 PATHWAY	15	15	All SZGR 2.0 genes in this pathway
BIOCARTA NFAT PATHWAY	56	45	All SZGR 2.0 genes in this pathway
BIOCARTA PTDINS PATHWAY	23	16	All SZGR 2.0 genes in this pathway
BIOCARTA PS1 PATHWAY	14	14	All SZGR 2.0 genes in this pathway
BIOCARTA EIF2 PATHWAY	11	8	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1MTOR PATHWAY	20	14	All SZGR 2.0 genes in this pathway
BIOCARTA SHH PATHWAY	16	15	All SZGR 2.0 genes in this pathway
BIOCARTA WNT PATHWAY	26	24	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
SIG IL4RECEPTOR IN B LYPHOCYTES	27	23	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES	51	41	All SZGR 2.0 genes in this pathway
SIG BCR SIGNALING PATHWAY	46	38	All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY	34	28	All SZGR 2.0 genes in this pathway
ST PHOSPHOINOSITIDE 3 KINASE PATHWAY	37	29	All SZGR 2.0 genes in this pathway
PID LYSOPHOSPHOLIPID PATHWAY	66	53	All SZGR 2.0 genes in this pathway
PID BETA CATENIN DEG PATHWAY	18	17	All SZGR 2.0 genes in this pathway
PID REELIN PATHWAY	29	29	All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY	46	39	All SZGR 2.0 genes in this pathway
PID ILK PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID CDC42 PATHWAY	70	51	All SZGR 2.0 genes in this pathway
PID LKB1 PATHWAY	47	37	All SZGR 2.0 genes in this pathway
PID WNT CANONICAL PATHWAY	20	18	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
PID REG GR PATHWAY	82	60	All SZGR 2.0 genes in this pathway
PID MYC PATHWAY	25	22	All SZGR 2.0 genes in this pathway
PID AR TF PATHWAY	53	38	All SZGR 2.0 genes in this pathway
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
PID HEDGEHOG GLI PATHWAY	48	35	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID DELTA NP63 PATHWAY	47	34	All SZGR 2.0 genes in this pathway
PID AURORA A PATHWAY	31	20	All SZGR 2.0 genes in this pathway
PID INSULIN GLUCOSE PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID PI3KCI AKT PATHWAY	35	30	All SZGR 2.0 genes in this pathway
PID P53 REGULATION PATHWAY	59	50	All SZGR 2.0 genes in this pathway
PID PI3K PLC TRK PATHWAY	36	31	All SZGR 2.0 genes in this pathway
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN	92	51	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER UP	142	96	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN	165	107	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP	147	101	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP	146	104	All SZGR 2.0 genes in this pathway
GALLUZZI PERMEABILIZE MITOCHONDRIA	43	31	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX	230	156	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 7	27	22	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN	225	163	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP	390	242	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C5	46	36	All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN	264	168	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA E2	118	65	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP	285	167	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN	210	128	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
MOOTHA GLYCOGEN METABOLISM	21	16	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP D	280	158	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-199	61	67	m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	61	67	m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-26	41	47	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	41	47	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GSK3B