SZGR2

Summary ?

GeneID	4690
Symbol	NCK1
Synonyms	NCK\|NCKalpha\|nck-1
Description	NCK adaptor protein 1
Reference	MIM:600508\|HGNC:HGNC:7664\|HPRD:02740\|
Gene type	protein-coding
Map location	3q21
Pascal p-value	1.628E-4
Sherlock p-value	0.832

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.6628

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C19orf53	0.90	0.83
USE1	0.89	0.80
MRPL27	0.89	0.83
MRPL20	0.88	0.85
MRPL24	0.88	0.85
FIS1	0.87	0.77
AURKAIP1	0.86	0.77
RNF181	0.86	0.77
GPX4	0.86	0.78
NDUFA2	0.86	0.81

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
BAT2D1	-0.42	-0.36
SLC6A6	-0.38	-0.32
TTN	-0.37	-0.34
AC008740.1	-0.37	-0.35
MYH9	-0.36	-0.28
MACF1	-0.36	-0.31
BDP1	-0.36	-0.30
RNF213	-0.36	-0.32
CDH5	-0.35	-0.32
MTR	-0.35	-0.28

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IPI	Neurotransmitter (GO term level: 4)	12110186
GO:0008093	cytoskeletal adaptor activity	NAS		12110186
GO:0030159	receptor signaling complex scaffold activity	NAS		12110186
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006417	regulation of translation	IEA		-
GO:0007172	signal complex assembly	NAS		12110186
GO:0007015	actin filament organization	IEA		-
GO:0016477	cell migration	IEA		-
GO:0042110	T cell activation	IMP		12110186
GO:0042102	positive regulation of T cell proliferation	IMP		12110186
GO:0030838	positive regulation of actin filament polymerization	IMP		12110186
GO:0030032	lamellipodium biogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0012506	vesicle membrane	IEA		-
GO:0005737	cytoplasm	NAS		12110186
GO:0005783	endoplasmic reticulum	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABI1	ABI-1 \| E3B1 \| NAP1BP \| SSH3BP \| SSH3BP1	abl-interactor 1	-	HPRD,BioGRID	11418237
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD,BioGRID	11494134
BCAR1	CAS \| CAS1 \| CASS1 \| CRKAS \| P130Cas	breast cancer anti-estrogen resistance 1	-	HPRD,BioGRID	12135674
BLNK	BASH \| BLNK-S \| LY57 \| MGC111051 \| SLP-65 \| SLP65	B-cell linker	-	HPRD,BioGRID	9697839 \|11487585
CAV2	CAV \| MGC12294	caveolin 2	-	HPRD,BioGRID	12091389
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	Affinity Capture-Western	BioGRID	10204582 \|11494134
CD3E	FLJ18683 \| T3E \| TCRE	CD3e molecule, epsilon (CD3-TCR complex)	Reconstituted Complex	BioGRID	12110186
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	Reconstituted Complex	BioGRID	8879209
DAG1	156DAG \| A3a \| AGRNR \| DAG	dystroglycan 1 (dystrophin-associated glycoprotein 1)	Affinity Capture-Western Reconstituted Complex	BioGRID	11724572
DCC	CRC18 \| CRCR1	deleted in colorectal carcinoma	-	HPRD,BioGRID	12149262
DNM1	DNM	dynamin 1	-	HPRD,BioGRID	10206341
DNM2	CMTDI1 \| CMTDIB \| DI-CMTB \| DYN2 \| DYNII	dynamin 2	An unspecified isoform of Dyn2 interacts with Nck. This interaction was modeled on a demonstrated interaction between human Dyn2 and Nck from an unspecified species.	BIND	15696170
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	-	HPRD	12087092
DOK2	p56DOK \| p56dok-2	docking protein 2, 56kDa	-	HPRD,BioGRID	11689432
DRD3	D3DR \| ETM1 \| FET1 \| MGC149204 \| MGC149205	dopamine receptor D3	D3 interacts with Nck.	BIND	9843378
DRD4	D4DR	dopamine receptor D4	D4.7 interacts with Nck.	BIND	9843378
DRD4	D4DR	dopamine receptor D4	D4.2 interacts with Nck.	BIND	9843378
DRD4	D4DR	dopamine receptor D4	-	HPRD,BioGRID	9843378
DRD4	D4DR	dopamine receptor D4	D4.4 interacts with Nck.	BIND	9843378
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD,BioGRID	9362449
EIF2B2	EIF-2Bbeta \| EIF2B	eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa	-	HPRD,BioGRID	11959995
EIF2S2	DKFZp686L18198 \| EIF2 \| EIF2B \| EIF2beta \| MGC8508	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	-	HPRD	11959995
EPHB1	ELK \| EPHT2 \| FLJ37986 \| Hek6 \| NET	EPH receptor B1	-	HPRD,BioGRID	9430661
EPHB2	CAPB \| DRT \| EPHT3 \| ERK \| Hek5 \| MGC87492 \| PCBC \| Tyro5	EPH receptor B2	-	HPRD	9233798
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	Affinity Capture-MS	BioGRID	16729043
FASLG	APT1LG1 \| CD178 \| CD95L \| FASL \| TNFSF6	Fas ligand (TNF superfamily, member 6)	-	HPRD,BioGRID	11741599
FLT1	FLT \| VEGFR1	fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)	Flt-1 interacts with Nck.	BIND	9600074
GAB2	KIAA0571	GRB2-associated binding protein 2	Reconstituted Complex	BioGRID	10391903
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	-	HPRD,BioGRID	9010224 \|9362449
LCP2	SLP-76 \| SLP76	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	Nck interacts with SLP-76.	BIND	15558067
LCP2	SLP-76 \| SLP76	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	-	HPRD,BioGRID	10229072
MAP4K1	HPK1	mitogen-activated protein kinase kinase kinase kinase 1	Reconstituted Complex Two-hybrid	BioGRID	9346925 \|9891069
MAP4K4	FLH21957 \| FLJ10410 \| FLJ20373 \| FLJ90111 \| HGK \| KIAA0687 \| NIK	mitogen-activated protein kinase kinase kinase kinase 4	-	HPRD,BioGRID	9135144
MINK1	B55 \| MAP4K6 \| MGC21111 \| MINK \| YSK2 \| ZC3 \| hMINK \| hMINKbeta	misshapen-like kinase 1 (zebrafish)	An unspecified isoform of hMINK-beta interacts with Nck. This interaction was modeled on a demonstrated interaction between human hMINK-beta and Nck from an unspecified species.	BIND	15469942
MINK1	B55 \| MAP4K6 \| MGC21111 \| MINK \| YSK2 \| ZC3 \| hMINK \| hMINKbeta	misshapen-like kinase 1 (zebrafish)	-	HPRD,BioGRID	15469942
NCKAP1	FLJ11291 \| HEM2 \| KIAA0587 \| MGC8981 \| NAP1 \| NAP125	NCK-associated protein 1	-	HPRD	11418237
NCKIPSD	AF3P21 \| DIP \| DIP1 \| MGC23891 \| ORF1 \| SPIN90 \| WASLBP \| WISH	NCK interacting protein with SH3 domain	-	HPRD,BioGRID	11278500
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	-	HPRD,BioGRID	8879209
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	-	HPRD	10808124
NTRK2	GP145-TrkB \| TRKB	neurotrophic tyrosine kinase, receptor, type 2	-	HPRD	12074588
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	-	HPRD	8824201 \|11278241
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	Nck interacts with PAK1	BIND	8824201
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	-	HPRD,BioGRID	8824201
PAK2	PAK65 \| PAKgamma	p21 protein (Cdc42/Rac)-activated kinase 2	-	HPRD	11160719
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	Autophosphorylated PDGFR interacts with Nck. This interaction was modelled on a demonstrated interaction between human PDGFR and Nck from an unspecified species.	BIND	8890167
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	-	HPRD	9362449
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	Affinity Capture-Western	BioGRID	1333047 \|10026169
PFN1	-	profilin 1	Reconstituted Complex	BioGRID	9694849
PKN2	MGC150606 \| MGC71074 \| PAK2 \| PRK2 \| PRKCL2 \| PRO2042 \| Pak-2	protein kinase N2	-	HPRD,BioGRID	8910519
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	Affinity Capture-Western Reconstituted Complex	BioGRID	8879209 \|11950595
PXN	FLJ16691	paxillin	-	HPRD,BioGRID	10330411
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	-	HPRD	10766742
RALGPS1	KIAA0351 \| RALGEF2 \| RALGPS1A	Ral GEF with PH domain and SH3 binding motif 1	Affinity Capture-Western	BioGRID	10747847
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD	10508618
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	Affinity Capture-Western	BioGRID	9233798
RHOU	ARHU \| CDC42L1 \| DJ646B12.2 \| FLJ10616 \| WRCH1 \| fJ646B12.2 \| hG28K	ras homolog gene family, member U	Wrch-1 interacts with Nck. This interaction was modeled on a demonstrated interaction between human Wrch-1, and Nck from an unspecified species.	BIND	15556869
RICS	GC-GAP \| GRIT \| KIAA0712 \| MGC1892 \| p200RhoGAP \| p250GAP	Rho GTPase-activating protein	Nck interacts with GC-GAP. This interaction was modelled on a demonstrated interaction between Nck from an unspecified species and human GC-GAP.	BIND	12819203
RICS	GC-GAP \| GRIT \| KIAA0712 \| MGC1892 \| p200RhoGAP \| p250GAP	Rho GTPase-activating protein	-	HPRD,BioGRID	12819203
RRAS	-	related RAS viral (r-ras) oncogene homolog	-	HPRD,BioGRID	10671570
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	Socs1 interacts with Nck. This interaction was modeled on a demonstrated interaction between mouse Socs1 and Nck from an unspecified species.	BIND	10022833
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	-	HPRD,BioGRID	10022833
SOCS7	NAP4	suppressor of cytokine signaling 7	-	HPRD,BioGRID	9344857
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	NCK interacts with SOS. This interaction was modeled on a demonstrated interaction between human NCK and mouse SOS or hamster SOS.	BIND	7862111
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	-	HPRD	7862111 \|10026169 \|10206341
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	Affinity Capture-Western Reconstituted Complex	BioGRID	7862111 \|8810325 \|10026169 \|10206341
SYNJ2	INPP5H \| KIAA0348 \| MGC44422	synaptojanin 2	-	HPRD	10805734
TBK1	FLJ11330 \| NAK \| T2K	TANK-binding kinase 1	-	HPRD,BioGRID	7706279
TNIK	-	TRAF2 and NCK interacting kinase	-	HPRD	10521462
TNK2	ACK \| ACK1 \| FLJ44758 \| FLJ45547 \| p21cdc42Hs	tyrosine kinase, non-receptor, 2	-	HPRD	11278436
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	Affinity Capture-Western in vitro in vivo	BioGRID	7565724 \|10747096 \|12135674
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	-	HPRD	7565724 \|11340081
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	Nck interacts with WASp.	BIND	15558067
WASL	DKFZp779G0847 \| MGC48327 \| N-WASP \| NWASP	Wiskott-Aldrich syndrome-like	-	HPRD,BioGRID	11340081
WIPF1	MGC111041 \| PRPL-2 \| WASPIP \| WIP	WAS/WASL interacting protein family, member 1	-	HPRD,BioGRID	9694849

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION	59	36	All SZGR 2.0 genes in this pathway
BIOCARTA ACTINY PATHWAY	20	14	All SZGR 2.0 genes in this pathway
ST T CELL SIGNAL TRANSDUCTION	45	33	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID TCR PATHWAY	66	51	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID RET PATHWAY	39	29	All SZGR 2.0 genes in this pathway
PID ARF6 PATHWAY	35	27	All SZGR 2.0 genes in this pathway
PID ANGIOPOIETIN RECEPTOR PATHWAY	50	41	All SZGR 2.0 genes in this pathway
PID NETRIN PATHWAY	32	27	All SZGR 2.0 genes in this pathway
PID ERBB1 RECEPTOR PROXIMAL PATHWAY	35	29	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID NEPHRIN NEPH1 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
PID VEGFR1 PATHWAY	26	23	All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY	42	34	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
PID FAK PATHWAY	59	45	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME ANTIGEN ACTIVATES B CELL RECEPTOR LEADING TO GENERATION OF SECOND MESSENGERS	29	24	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR	126	90	All SZGR 2.0 genes in this pathway
REACTOME TCR SIGNALING	54	46	All SZGR 2.0 genes in this pathway
REACTOME GENERATION OF SECOND MESSENGER MOLECULES	27	25	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY PDGF	122	93	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION	95	76	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATION OF RAC	14	11	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ROBO RECEPTOR	30	26	All SZGR 2.0 genes in this pathway
REACTOME NETRIN1 SIGNALING	41	30	All SZGR 2.0 genes in this pathway
REACTOME DCC MEDIATED ATTRACTIVE SIGNALING	13	11	All SZGR 2.0 genes in this pathway
REACTOME NEPHRIN INTERACTIONS	20	15	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 2HR DN	88	53	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP	211	136	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS C UP	170	114	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
MEINHOLD OVARIAN CANCER LOW GRADE DN	20	16	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 BULK DN	23	15	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
PUJANA BRCA CENTERED NETWORK	117	72	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP	223	140	All SZGR 2.0 genes in this pathway
HOFMANN CELL LYMPHOMA UP	50	35	All SZGR 2.0 genes in this pathway
CROMER METASTASIS DN	81	58	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C4	18	12	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D6	37	25	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN	154	101	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN	240	153	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER WITH BRCA1 MUTATED UP	56	27	All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP	83	63	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-137	460	466	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NCK1