Gene Page: GALNT10
Summary ?
GeneID | 55568 |
Symbol | GALNT10 |
Synonyms | GALNACT10|PPGALNACT10|PPGANTASE10 |
Description | polypeptide N-acetylgalactosaminyltransferase 10 |
Reference | MIM:608043|HGNC:HGNC:19873|Ensembl:ENSG00000164574|HPRD:12157|Vega:OTTHUMG00000130145 |
Gene type | protein-coding |
Map location | 5q33.2 |
Pascal p-value | 3.968E-8 |
Fetal beta | 0.758 |
eGene | Cerebellar Hemisphere |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 |
Section I. Genetics and epigenetics annotation
CV:PGC128
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs11740474 | chr5 | 153680747 | AT | 3.936E-8 | intronic | GALNT10 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005529 | sugar binding | IEA | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0004653 | polypeptide N-acetylgalactosaminyltransferase activity | IEA | - | |
GO:0016757 | transferase activity, transferring glycosyl groups | IEA | - | |
GO:0030145 | manganese ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006493 | protein amino acid O-linked glycosylation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG O GLYCAN BIOSYNTHESIS | 30 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME O LINKED GLYCOSYLATION OF MUCINS | 59 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF PROTEINS | 518 | 242 | All SZGR 2.0 genes in this pathway |
REACTOME POST TRANSLATIONAL PROTEIN MODIFICATION | 188 | 116 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
ROVERSI GLIOMA COPY NUMBER UP | 100 | 75 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
MATTIOLI MULTIPLE MYELOMA WITH 14Q32 TRANSLOCATIONS | 36 | 25 | All SZGR 2.0 genes in this pathway |
SILIGAN BOUND BY EWS FLT1 FUSION | 47 | 34 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 SIGNALING VIA CTNNB1 | 83 | 58 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS REQUIRE MYC | 210 | 123 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BRUECKNER TARGETS OF MIRLET7A3 DN | 78 | 49 | All SZGR 2.0 genes in this pathway |
BOHN PRIMARY IMMUNODEFICIENCY SYNDROM DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
WAGNER APO2 SENSITIVITY | 25 | 14 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR DN | 251 | 151 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR DN | 91 | 56 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 DN | 82 | 51 | All SZGR 2.0 genes in this pathway |
KIM PTEN TARGETS UP | 18 | 9 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 2072 | 2078 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-26 | 2055 | 2061 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.