SZGR2

Summary ?

GeneID	7528
Symbol	YY1
Synonyms	DELTA\|INO80S\|NF-E1\|UCRBP\|YIN-YANG-1
Description	YY1 transcription factor
Reference	MIM:600013\|HGNC:HGNC:12856\|HPRD:02482\|
Gene type	protein-coding
Map location	14q
Pascal p-value	0.501
Sherlock p-value	3.053E-4
Fetal beta	0.117
eGene	Nucleus accumbens basal ganglia Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0278

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs17145698	chrX	40218345	YY1	7528		0.18		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MARK3	0.94	0.95
ZNF280D	0.93	0.94
LEO1	0.93	0.95
ZNF711	0.92	0.95
REV1	0.92	0.94
SCAPER	0.91	0.94
TTC17	0.91	0.93
SR140	0.91	0.94
C10orf137	0.91	0.94
ZFP28	0.91	0.95

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.82	-0.88
MT-CO2	-0.81	-0.88
AF347015.27	-0.81	-0.87
AF347015.33	-0.79	-0.86
FXYD1	-0.79	-0.86
IFI27	-0.79	-0.87
MT-CYB	-0.78	-0.85
AF347015.8	-0.78	-0.87
HIGD1B	-0.77	-0.86
HLA-F	-0.77	-0.79

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		1946405
GO:0003713	transcription coactivator activity	TAS		1946405
GO:0003714	transcription corepressor activity	TAS		1655281
GO:0005515	protein binding	IPI		9016636
GO:0008270	zinc ion binding	TAS		1655281
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		1655281
GO:0006350	transcription	IEA		-
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0048593	camera-type eye morphogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005667	transcription factor complex	IEA		-
GO:0005737	cytoplasm	IDA		18029348
GO:0005886	plasma membrane	IDA		18029348
GO:0016363	nuclear matrix	IEA		-
GO:0031519	PcG protein complex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	YY1 interacts with ATF-2.	BIND	7769693
ATF6	ATF6A	activating transcription factor 6	-	HPRD,BioGRID	10866666
ATF7	ATFA \| MGC57182	activating transcription factor 7	YY1 interacts with ATFa2.	BIND	7769693
ATF7	ATFA \| MGC57182	activating transcription factor 7	YY1 interacts with ATFa3.	BIND	7769693
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	YY1 interacts with p14ARF.	BIND	15210108
CREB1	CREB \| MGC9284	cAMP responsive element binding protein 1	YY1 interacts with CREB.	BIND	7769693
DNAJB4	DNAJW \| DjB4 \| HLJ1	DnaJ (Hsp40) homolog, subfamily B, member 4	YY1 interacts with HLJ1 YY1-binding site.	BIND	15782117
E2F2	E2F-2	E2F transcription factor 2	-	HPRD	12411495
E2F3	DKFZp686C18211 \| E2F-3 \| KIAA0075 \| MGC104598	E2F transcription factor 3	-	HPRD	12411495
EED	HEED \| WAIT1	embryonic ectoderm development	YY1 interacts with EED.	BIND	14610174
EED	HEED \| WAIT1	embryonic ectoderm development	EED interacts with YY1.	BIND	11158321
EP300	KAT3B \| p300	E1A binding protein p300	Affinity Capture-Western Biochemical Activity Reconstituted Complex Two-hybrid	BioGRID	7758944 \|11486036
EZH2	ENX-1 \| EZH1 \| KMT6 \| MGC9169	enhancer of zeste homolog 2 (Drosophila)	EED interacts with EZH2.	BIND	14610174
FKBP1A	FKBP-12 \| FKBP1 \| FKBP12 \| FKBP12C \| PKC12 \| PKCI2 \| PPIASE	FK506 binding protein 1A, 12kDa	Two-hybrid	BioGRID	7541038
FKBP3	FKBP-25 \| PPIase	FK506 binding protein 3, 25kDa	Affinity Capture-Western Reconstituted Complex	BioGRID	11532945
GTF2I	BAP-135 \| BAP135 \| BTKAP1 \| DIWS \| FLJ38776 \| FLJ56355 \| IB291 \| SPIN \| TFII-I \| WBS \| WBSCR6	general transcription factor II, i	-	HPRD	11287625
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	Reconstituted Complex	BioGRID	9346952
HDAC2	RPD3 \| YAF1	histone deacetylase 2	YY1 interacts with RPD3. This interaction was modelled on a demonstrated interaction between human YY1 and mouse RPD3.	BIND	8917507
HDAC2	RPD3 \| YAF1	histone deacetylase 2	-	HPRD,BioGRID	11486036
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD,BioGRID	9346952
KAT2B	CAF \| P \| P/CAF \| PCAF	K(lysine) acetyltransferase 2B	Biochemical Activity	BioGRID	11486036
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	YY1 interacts with Hdm2.	BIND	15210108
MTA2	DKFZp686F2281 \| MTA1L1 \| PID	metastasis associated 1 family, member 2	Reconstituted Complex	BioGRID	12920132
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	-	HPRD,BioGRID	8266081
NOTCH1	TAN1 \| hN1	Notch homolog 1, translocation-associated (Drosophila)	-	HPRD,BioGRID	12913000
RYBP	AAP1 \| DEDAF \| YEAF1	RING1 and YY1 binding protein	-	HPRD,BioGRID	10369680
SAP30	-	Sin3A-associated protein, 30kDa	-	HPRD,BioGRID	12788099
SP1	-	Sp1 transcription factor	Affinity Capture-Western	BioGRID	10224053
SP1	-	Sp1 transcription factor	YY1 interacts with Sp1.	BIND	8327494
SREBF1	SREBP-1c \| SREBP1 \| bHLHd1	sterol regulatory element binding transcription factor 1	Reconstituted Complex	BioGRID	10224053
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	YY1 interacts with p53.	BIND	15210108
YAF2	MGC41856	YY1 associated factor 2	-	HPRD,BioGRID	9016636
ZRANB2	DKFZp686J1831 \| DKFZp686N09117 \| FLJ41119 \| ZIS \| ZIS1 \| ZIS2 \| ZNF265	zinc finger, RAN-binding domain containing 2	-	HPRD	11448987

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID NOTCH PATHWAY	59	49	All SZGR 2.0 genes in this pathway
PID E2F PATHWAY	74	48	All SZGR 2.0 genes in this pathway
PID HDAC CLASSI PATHWAY	66	50	All SZGR 2.0 genes in this pathway
PID MTOR 4PATHWAY	69	55	All SZGR 2.0 genes in this pathway
PID P53 REGULATION PATHWAY	59	50	All SZGR 2.0 genes in this pathway
PID HES HEY PATHWAY	48	39	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN	68	49	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS TOP50 UP	38	27	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS REPRESSED BY SERUM	159	93	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 240 HELA	60	43	All SZGR 2.0 genes in this pathway
CHEOK RESPONSE TO MERCAPTOPURINE AND LD MTX UP	10	6	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN	225	163	All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH REARRANGEMENTS DN	48	26	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C2	54	39	All SZGR 2.0 genes in this pathway
MARIADASON REGULATED BY HISTONE ACETYLATION DN	54	30	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS DN	53	34	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP	101	69	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D8	40	29	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
CROONQUIST STROMAL STIMULATION DN	13	7	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN	222	147	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1	148	95	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway
WANG TNF TARGETS	24	17	All SZGR 2.0 genes in this pathway
YUAN ZNF143 PARTNERS	22	15	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-141/200a	669	675	1A	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	669	675	1A	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-142-5p	296	302	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-181	789	795	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-186	293	300	1A,m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
				hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
				hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-29	774	780	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-34/449	720	726	1A	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-381	605	611	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-381	605	611	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-384	90	96	m8	hsa-miR-384	AUUCCUAGAAAUUGUUCAUA
miR-410	546	553	1A,m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-433-3p	269	275	1A	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: YY1