Gene Page: ENAH
Summary ?
GeneID | 55740 |
Symbol | ENAH |
Synonyms | ENA|MENA|NDPP1 |
Description | enabled homolog (Drosophila) |
Reference | MIM:609061|HGNC:HGNC:18271|Ensembl:ENSG00000154380|HPRD:12360|Vega:OTTHUMG00000037742 |
Gene type | protein-coding |
Map location | 1q42.12 |
Sherlock p-value | 0.235 |
Support | G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0017124 | SH3 domain binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0046907 | intracellular transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABI1 | ABI-1 | E3B1 | NAP1BP | SSH3BP | SSH3BP1 | abl-interactor 1 | - | HPRD,BioGRID | 12672821 |
BAIAP2 | BAP2 | IRSP53 | BAI1-associated protein 2 | Reconstituted Complex | BioGRID | 11696321 |
DNMBP | KIAA1010 | TUBA | dynamin binding protein | - | HPRD,BioGRID | 14506234 |
ERMAP | MGC118810 | MGC118811 | MGC118812 | MGC118813 | PRO2801 | RD | SC | erythroblast membrane-associated protein (Scianna blood group) | - | HPRD | 15469845 |
FAT1 | CDHF7 | FAT | ME5 | hFat1 | FAT tumor suppressor homolog 1 (Drosophila) | - | HPRD | 15148305 |
FYB | ADAP | PRO0823 | SLAP-130 | FYN binding protein (FYB-120/130) | - | HPRD | 10747096 |
GPHN | GEPH | GPH | GPHRYN | KIAA1385 | gephyrin | - | HPRD | 12967995 |
PFN1 | - | profilin 1 | - | HPRD,BioGRID | 9473484 |
RAPH1 | ALS2CR18 | ALS2CR9 | KIAA1681 | LPD | PREL2 | RMO1 | RalGDS/AF-6 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | Affinity Capture-Western | BioGRID | 15469845 |
ROBO4 | FLJ20798 | MGC133352 | MGC133353 | MRB | roundabout homolog 4, magic roundabout (Drosophila) | - | HPRD | 12941633 |
TES | DKFZp586B2022 | MGC1146 | TESS | TESS-2 | testis derived transcript (3 LIM domains) | TES interacts with mena | BIND | 12571287 |
TES | DKFZp586B2022 | MGC1146 | TESS | TESS-2 | testis derived transcript (3 LIM domains) | Affinity Capture-Western Reconstituted Complex | BioGRID | 12695497 |
XPO6 | EXP6 | FLJ22519 | KIAA0370 | RANBP20 | exportin 6 | Affinity Capture-MS | BioGRID | 14592989 |
ZYX | ESP-2 | HED-2 | zyxin | - | HPRD,BioGRID | 10801818 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
PID CDC42 PATHWAY | 70 | 51 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN NASCENT AJ PATHWAY | 39 | 33 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN STABILIZATION PATHWAY | 42 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME TCR SIGNALING | 54 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME GENERATION OF SECOND MESSENGER MOLECULES | 27 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ROBO RECEPTOR | 30 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP | 120 | 73 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 CHRONIC LOF DN | 118 | 78 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST TUMORS 324 UP | 150 | 93 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
DARWICHE SKIN TUMOR PROMOTER UP | 142 | 96 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH UP | 147 | 101 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA UP | 146 | 104 | All SZGR 2.0 genes in this pathway |
AIYAR COBRA1 TARGETS UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
BRUNO HEMATOPOIESIS | 66 | 48 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
KUNINGER IGF1 VS PDGFB TARGETS UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
KEEN RESPONSE TO ROSIGLITAZONE DN | 106 | 68 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 8G | 95 | 62 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
POS HISTAMINE RESPONSE NETWORK | 32 | 22 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA E2 | 118 | 65 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
RAY TUMORIGENESIS BY ERBB2 CDC25A DN | 159 | 105 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C DN | 59 | 39 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G123 UP | 45 | 21 | All SZGR 2.0 genes in this pathway |
LOPEZ MESOTHELIOMA SURVIVAL DN | 12 | 6 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 UP | 80 | 54 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA MF DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
GABRIELY MIR21 TARGETS | 289 | 187 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS UP | 112 | 65 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 COMPLETE | 227 | 151 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 2256 | 2262 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 2612 | 2619 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-130/301 | 2241 | 2247 | 1A | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-139 | 1871 | 1877 | 1A | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-15/16/195/424/497 | 198 | 204 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-181 | 2805 | 2811 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU | ||||
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-183 | 1655 | 1662 | 1A,m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-224 | 1060 | 1066 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-27 | 2613 | 2619 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-320 | 10826 | 10832 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-375 | 530 | 536 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
miR-376 | 732 | 738 | m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
miR-493-5p | 2688 | 2695 | 1A,m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.