SZGR2

Summary ?

GeneID	9547
Symbol	CXCL14
Synonyms	BMAC\|BRAK\|KEC\|KS1\|MIP-2g\|MIP2G\|NJAC\|SCYB14
Description	C-X-C motif chemokine ligand 14
Reference	MIM:604186\|HGNC:HGNC:10640\|Ensembl:ENSG00000145824\|HPRD:16049\|Vega:OTTHUMG00000129139
Gene type	protein-coding
Map location	5q31
Pascal p-value	0.023
Sherlock p-value	0.658
Fetal beta	-3.644
DMG	1 (# studies)
eGene	Nucleus accumbens basal ganglia

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_I	Genome scan meta-analysis	Psr: 0.0032

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg01821923	5	134914371	CXCL14	4.711E-4	-0.421	0.046	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008009	chemokine activity	TAS		10049774
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007267	cell-cell signaling	TAS		10049774
GO:0007165	signal transduction	TAS		10049774
GO:0006955	immune response	IEA		-
GO:0006935	chemotaxis	TAS		10049774
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IDA		11256614
GO:0005576	extracellular region	IEA		-
GO:0005615	extracellular space	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION	267	161	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
WATANABE COLON CANCER MSI VS MSS DN	81	42	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS DN	232	139	All SZGR 2.0 genes in this pathway
SENESE HDAC2 TARGETS DN	133	77	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP	162	116	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF UP	215	137	All SZGR 2.0 genes in this pathway
KERLEY RESPONSE TO CISPLATIN UP	44	30	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP	214	144	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK UP	271	175	All SZGR 2.0 genes in this pathway
KAN RESPONSE TO ARSENIC TRIOXIDE	123	80	All SZGR 2.0 genes in this pathway
MAHADEVAN IMATINIB RESISTANCE UP	23	15	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION DN	100	64	All SZGR 2.0 genes in this pathway
KANG GIST WITH PDGFRA UP	50	27	All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP	77	60	All SZGR 2.0 genes in this pathway
FRIDMAN IMMORTALIZATION DN	34	24	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP	116	79	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP	108	75	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
ABBUD LIF SIGNALING 1 UP	46	29	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL	254	164	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP	222	139	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP	487	303	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 UP	81	52	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN LUNG DN	37	22	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL A UP	84	52	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
ITO PTTG1 TARGETS UP	12	9	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH DN	31	25	All SZGR 2.0 genes in this pathway
HUPER BREAST BASAL VS LUMINAL UP	54	29	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
FINAK BREAST CANCER SDPP SIGNATURE	26	11	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
NAKAYAMA FGF2 TARGETS	29	17	All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS DN	46	26	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN	267	160	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1	68	50	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2	182	102	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
KIM GLIS2 TARGETS UP	84	61	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP	199	143	All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP	266	142	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-410	142	148	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-539	118	124	1A	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CXCL14