Summary ?
GeneID9547
SymbolCXCL14
SynonymsBMAC|BRAK|KEC|KS1|MIP-2g|MIP2G|NJAC|SCYB14
DescriptionC-X-C motif chemokine ligand 14
ReferenceMIM:604186|HGNC:HGNC:10640|Ensembl:ENSG00000145824|HPRD:16049|Vega:OTTHUMG00000129139
Gene typeprotein-coding
Map location5q31
Pascal p-value0.023
Sherlock p-value0.658
Fetal beta-3.644
DMG1 (# studies)
eGeneNucleus accumbens basal ganglia

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IGenome scan meta-analysisPsr: 0.0032 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg018219235134914371CXCL144.711E-4-0.4210.046DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008009chemokine activityTAS10049774 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007267cell-cell signalingTAS10049774 
GO:0007165signal transductionTAS10049774 
GO:0006955immune responseIEA-
GO:0006935chemotaxisTAS10049774 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIDA11256614 
GO:0005576extracellular regionIEA-
GO:0005615extracellular spaceIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION 267161All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY 190128All SZGR 2.0 genes in this pathway
WATANABE COLON CANCER MSI VS MSS DN 8142All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN 258141All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS DN 232139All SZGR 2.0 genes in this pathway
SENESE HDAC2 TARGETS DN 13377All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536332All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP 162116All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508354All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP 329196All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF UP 215137All SZGR 2.0 genes in this pathway
KERLEY RESPONSE TO CISPLATIN UP 4430All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP 214144All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK UP 271175All SZGR 2.0 genes in this pathway
KAN RESPONSE TO ARSENIC TRIOXIDE 12380All SZGR 2.0 genes in this pathway
MAHADEVAN IMATINIB RESISTANCE UP 2315All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174695All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355243All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205145All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION DN 10064All SZGR 2.0 genes in this pathway
KANG GIST WITH PDGFRA UP 5027All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP 7760All SZGR 2.0 genes in this pathway
FRIDMAN IMMORTALIZATION DN 3424All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP 11679All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648385All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP 10875All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN 366238All SZGR 2.0 genes in this pathway
ABBUD LIF SIGNALING 1 UP 4629All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237837All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL 254164All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP 222139All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487303All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 UP 8152All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543317All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602364All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591366All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN LUNG DN 3722All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL A UP 8452All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701446All SZGR 2.0 genes in this pathway
ITO PTTG1 TARGETS UP 129All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260174All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH DN 3125All SZGR 2.0 genes in this pathway
HUPER BREAST BASAL VS LUMINAL UP 5429All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN 435289All SZGR 2.0 genes in this pathway
FINAK BREAST CANCER SDPP SIGNATURE 2611All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210725All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349234All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435318All SZGR 2.0 genes in this pathway
NAKAYAMA FGF2 TARGETS 2917All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS DN 4626All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN 267160All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721492All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341243All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1 6850All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 182102All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857456All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137655All SZGR 2.0 genes in this pathway
KIM GLIS2 TARGETS UP 8461All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN 187109All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP 199143All SZGR 2.0 genes in this pathway
FOSTER KDM1A TARGETS UP 266142All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489314All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344197All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753411All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028559All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4101421481Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-5391181241Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU