Gene Page: LSM5
Summary ?
GeneID | 23658 |
Symbol | LSM5 |
Synonyms | YER146W |
Description | LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated |
Reference | MIM:607285|HGNC:HGNC:17162|Ensembl:ENSG00000106355|HPRD:06285|Vega:OTTHUMG00000022913 |
Gene type | protein-coding |
Map location | 7p14.3 |
Pascal p-value | 0.048 |
Sherlock p-value | 0.304 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0139 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003723 | RNA binding | TAS | 10369684 | |
GO:0005515 | protein binding | IPI | 15231747 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006397 | mRNA processing | TAS | 10369684 | |
GO:0008380 | RNA splicing | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | TAS | 10369684 | |
GO:0030529 | ribonucleoprotein complex | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
EXOSC5 | MGC111224 | MGC12901 | RRP41B | RRP46 | Rrp46p | hRrp46p | p12B | exosome component 5 | - | HPRD,BioGRID | 15231747 |
HNRNPD | AUF1 | AUF1A | HNRPD | P37 | hnRNPD0 | heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) | - | HPRD,BioGRID | 15231747 |
LSM1 | CASM | YJL124C | LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD | 11920408 |
LSM2 | C6orf28 | G7b | YBL026W | snRNP | LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD | 11920408 |
LSM3 | SMX4 | USS2 | YLR438C | LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD | 11920408 |
LSM4 | YER112W | LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD | 11920408 |
LSM6 | YDR378C | LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD | 11920408 |
LSM7 | YNL147W | LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD | 11920408 |
LSM8 | YJR022W | LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) | - | HPRD | 11920408 |
SMN1 | BCD541 | SMA | SMA1 | SMA2 | SMA3 | SMA4 | SMA@ | SMN | SMNT | T-BCD541 | survival of motor neuron 1, telomeric | - | HPRD | 10851237 |
SNRPE | B-raf | SME | small nuclear ribonucleoprotein polypeptide E | - | HPRD,BioGRID | 15231747 |
SNRPF | SMF | small nuclear ribonucleoprotein polypeptide F | - | HPRD,BioGRID | 15231747 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG RNA DEGRADATION | 59 | 37 | All SZGR 2.0 genes in this pathway |
KEGG SPLICEOSOME | 128 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA DECAY BY 5 TO 3 EXORIBONUCLEASE | 15 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
REACTOME DEADENYLATION DEPENDENT MRNA DECAY | 48 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA PROGENITOR DN | 66 | 42 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
HOEBEKE LYMPHOID STEM CELL DN | 86 | 59 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
DITTMER PTHLH TARGETS UP | 112 | 68 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP | 181 | 101 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
XU HGF TARGETS INDUCED BY AKT1 6HR | 19 | 8 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING UP | 108 | 69 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE UP | 167 | 92 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
MOREAUX B LYMPHOCYTE MATURATION BY TACI DN | 73 | 45 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI DN | 172 | 107 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
BOUDOUKHA BOUND BY IGF2BP2 | 111 | 59 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-204/211 | 112 | 119 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.