SZGR2

Summary ?

GeneID	4609
Symbol	MYC
Synonyms	MRTL\|MYCC\|bHLHe39\|c-Myc
Description	v-myc avian myelocytomatosis viral oncogene homolog
Reference	MIM:190080\|HGNC:HGNC:7553\|Ensembl:ENSG00000136997\|HPRD:01818\|Vega:OTTHUMG00000128475
Gene type	protein-coding
Map location	8q24.21
Pascal p-value	3.014E-4
Fetal beta	2.211
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression	Meta-analysis of gene expression	P value: 1.408
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0359

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg16100135	8	128750586	MYC	3.48E-9	-0.02	2.27E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs10094528	chr8	9740328	MYC	4609	0.08	trans
rs7107744	chr11	128268778	MYC	4609	0.1	trans
rs837543	chr16	55500411	MYC	4609	0.06	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TSKU	0.69	0.71
C3orf54	0.64	0.71
TTLL12	0.64	0.62
NEUROD2	0.64	0.59
TP53I11	0.63	0.67
PTPN2	0.63	0.64
NKAIN1	0.63	0.68
NXPH3	0.63	0.47
DBN1	0.62	0.66
IMPDH2	0.62	0.69

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FBXO2	-0.47	-0.68
HLA-F	-0.46	-0.66
AIFM3	-0.46	-0.64
C5orf53	-0.45	-0.63
ARHGAP22	-0.45	-0.65
LDHD	-0.45	-0.63
ALDOC	-0.44	-0.62
CLU	-0.44	-0.63
HEPN1	-0.44	-0.62
CSRP1	-0.44	-0.69

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	NAS		2834731
GO:0003700	transcription factor activity	TAS		9924025
GO:0005515	protein binding	IPI		9308237 \|9708738 \|10597290 \|12706874
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001836	release of cytochrome c from mitochondria	IEA		-
GO:0001783	B cell apoptosis	IEA		-
GO:0006309	DNA fragmentation during apoptosis	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	NAS		2834731
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		9924025
GO:0007050	cell cycle arrest	TAS		10962037
GO:0008284	positive regulation of cell proliferation	IDA		15994933
GO:0008629	induction of apoptosis by intracellular signals	IEA		-
GO:0008633	activation of pro-apoptotic gene products	IEA		-
GO:0008634	negative regulation of survival gene product expression	IEA		-
GO:0006919	caspase activation	IEA		-
GO:0006879	cellular iron ion homeostasis	TAS		9924025
GO:0009314	response to radiation	IEA		-
GO:0042981	regulation of apoptosis	IEA		-
GO:0016485	protein processing	IEA		-
GO:0042474	middle ear morphogenesis	IEA		-
GO:0043473	pigmentation	IEA		-
GO:0043279	response to alkaloid	IEA		-
GO:0050910	detection of mechanical stimulus involved in sensory perception of sound	IEA		-
GO:0048705	skeletal system morphogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005819	spindle	IEA		-
GO:0005634	nucleus	IDA		15994933
GO:0005634	nucleus	NAS		2834731
GO:0016604	nuclear body	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTB	PS1TP5BP1	actin, beta	Co-purification	BioGRID	11839798
ACTL6A	ACTL6 \| Arp4 \| BAF53A \| INO80K \| MGC5382	actin-like 6A	-	HPRD,BioGRID	11839798
ARHGEF2	DKFZp547L106 \| DKFZp547P1516 \| GEF \| GEF-H1 \| GEFH1 \| KIAA0651 \| LFP40 \| P40	rho/rac guanine nucleotide exchange factor (GEF) 2	Affinity Capture-MS	BioGRID	17353931
BCL2	Bcl-2	B-cell CLL/lymphoma 2	Affinity Capture-Western Co-localization	BioGRID	15210690
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	9788437
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 association with c-Myc, a proto-oncogene that is implicated in tumorigenesis, embryonic development and apoptosis, inhibits its transcriptional and transforming activity in cells.	BIND	9788437
CCNT1	CCNT \| CYCT1	cyclin T1	-	HPRD,BioGRID	12944920
CD6	FLJ44171 \| TP120	CD6 molecule	Affinity Capture-Western	BioGRID	10899308
CDC6	CDC18L \| HsCDC18 \| HsCDC6	cell division cycle 6 homolog (S. cerevisiae)	-	HPRD,BioGRID	10899308
CDK4	CMM3 \| MGC14458 \| PSK-J3	cyclin-dependent kinase 4	MYC (c-Myc) interacts with CDK4 promoter.	BIND	12857727
CDK9	C-2k \| CDC2L4 \| CTK1 \| PITALRE \| TAK	cyclin-dependent kinase 9	Affinity Capture-Western	BioGRID	12944920
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	Myc interacts with CDKN1A promoter.	BIND	15780936
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	c-Myc binds the proximal region of the p21Cip1 promoter.	BIND	15084259
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	c-Myc interacts with p21WAF1 promoter.	BIND	15856024
CDKN2A	ARF \| CDK4I \| CDKN2 \| CMM2 \| INK4 \| INK4a \| MLM \| MTS1 \| TP16 \| p14 \| p14ARF \| p16 \| p16INK4 \| p16INK4a \| p19	cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	p14ARF interacts with c-Myc.	BIND	15361884
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	-	HPRD,BioGRID	12873812
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	12873812
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	IKK-alpha interacts with c-myc promoter.	BIND	15808510
CSNK2A1	CK2A1 \| CKII	casein kinase 2, alpha 1 polypeptide	CK2 interacts with and phosphorylates c-Myc. This interaction was modelled on a demonstrated interaction between mouse CK2 and human c-Myc.	BIND	12149649
DDB2	DDBB \| FLJ34321 \| UV-DDB2	damage-specific DNA binding protein 2, 48kDa	c-Myc interacts with DDB2 promoter.	BIND	15856024
DDX24	-	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24	Affinity Capture-MS	BioGRID	17353931
DNMT3A	DNMT3A2 \| M.HsaIIIA	DNA (cytosine-5-)-methyltransferase 3 alpha	Myc interacts with Dmnt3a.	BIND	15616584
DNMT3A	DNMT3A2 \| M.HsaIIIA	DNA (cytosine-5-)-methyltransferase 3 alpha	-	HPRD,BioGRID	15616584
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	E2F-1 interacts with the MYC gene P2 promoter region.	BIND	7892279
E2F4	E2F-4	E2F transcription factor 4, p107/p130-binding	E2F-4 interacts with the MYC gene P2 promoter region.	BIND	7892279
E2F5	E2F-5	E2F transcription factor 5, p130-binding	E2F-5 interacts with the MYC gene P2 promoter region.	BIND	7892279
EFTUD2	DKFZp686E24196 \| FLJ44695 \| KIAA0031 \| Snrp116 \| Snu114 \| U5-116KD	elongation factor Tu GTP binding domain containing 2	Affinity Capture-MS	BioGRID	17353931
EP400	CAGH32 \| DKFZP434I225 \| FLJ42018 \| FLJ45115 \| P400 \| TNRC12	E1A binding protein p400	Affinity Capture-Western Reconstituted Complex	BioGRID	11509179
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	ER-alpha interacts with c-myc promoter.	BIND	15808510
EXOC4	MGC27170 \| REC8 \| SEC8 \| SEC8L1 \| Sec8p	exocyst complex component 4	Affinity Capture-MS	BioGRID	17353931
FANCI	FLJ10719 \| KIAA1794	Fanconi anemia, complementation group I	Affinity Capture-MS	BioGRID	17353931
FBXW7	AGO \| CDC4 \| DKFZp686F23254 \| FBW6 \| FBW7 \| FBX30 \| FBXO30 \| FBXW6 \| FLJ16457 \| SEL-10 \| SEL10	F-box and WD repeat domain containing 7	Fbw7-alpha interacts with c-Myc.	BIND	16023596
FBXW7	AGO \| CDC4 \| DKFZp686F23254 \| FBW6 \| FBW7 \| FBX30 \| FBXO30 \| FBXW6 \| FLJ16457 \| SEL-10 \| SEL10	F-box and WD repeat domain containing 7	Fbw7-beta interacts with c-Myc.	BIND	16023596
FUBP1	FBP \| FUBP	far upstream element (FUSE) binding protein 1	FBP interacts with FUSE.	BIND	15502847
GCN1L1	GCN1 \| GCN1L \| KIAA0219	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	Affinity Capture-MS	BioGRID	17353931
GEMIN4	DKFZp434B131 \| DKFZp434D174 \| HC56 \| HCAP1 \| HHRF-1 \| p97	gem (nuclear organelle) associated protein 4	Affinity Capture-MS	BioGRID	17353931
GTF2B	TF2B \| TFIIB	general transcription factor IIB	Reconstituted Complex	BioGRID	12660246
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	-	HPRD,BioGRID	8755740
GTF2I	BAP-135 \| BAP135 \| BTKAP1 \| DIWS \| FLJ38776 \| FLJ56355 \| IB291 \| SPIN \| TFII-I \| WBS \| WBSCR6	general transcription factor II, i	-	HPRD,BioGRID	8377829
GTF3C3	TFIIIC102 \| TFIIICgamma \| TFiiiC2-102	general transcription factor IIIC, polypeptide 3, 102kDa	Affinity Capture-MS	BioGRID	17353931
HEATR1	BAP28 \| FLJ10359 \| MGC72083	HEAT repeat containing 1	Affinity Capture-MS	BioGRID	17353931
HNRNPC	C1 \| C2 \| HNRNP \| HNRPC \| MGC104306 \| MGC105117 \| MGC117353 \| MGC131677 \| SNRPC	heterogeneous nuclear ribonucleoprotein C (C1/C2)	Affinity Capture-MS	BioGRID	17353931
HSP90AA1	FLJ31884 \| HSP86 \| HSP89A \| HSP90A \| HSP90N \| HSPC1 \| HSPCA \| HSPCAL1 \| HSPCAL4 \| HSPN \| Hsp89 \| Hsp90 \| LAP2	heat shock protein 90kDa alpha (cytosolic), class A member 1	-	HPRD,BioGRID	12644583
KAT2A	GCN5 \| GCN5L2 \| MGC102791 \| PCAF-b \| hGCN5	K(lysine) acetyltransferase 2A	c-Myc interacts with GNC5L.	BIND	12660246
KAT2A	GCN5 \| GCN5L2 \| MGC102791 \| PCAF-b \| hGCN5	K(lysine) acetyltransferase 2A	Affinity Capture-Western	BioGRID	10611234
KAT2B	CAF \| P \| P/CAF \| PCAF	K(lysine) acetyltransferase 2B	Affinity Capture-Western Co-purification Reconstituted Complex	BioGRID	12660246
KAT5	ESA1 \| HTATIP \| HTATIP1 \| PLIP \| TIP \| TIP60 \| cPLA2	K(lysine) acetyltransferase 5	-	HPRD,BioGRID	12776177
KIAA0859	5630401D24Rik \| CGI-01 \| FLJ10310	KIAA0859	Affinity Capture-MS	BioGRID	17353931
KIAA1967	DBC-1 \| DBC1	KIAA1967	Affinity Capture-MS	BioGRID	17353931
MAP2K1	MAPKK1 \| MEK1 \| MKK1 \| PRKMK1	mitogen-activated protein kinase kinase 1	-	HPRD	7957875
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	Biochemical Activity Reconstituted Complex	BioGRID	7957875 \|9207092 \|15210690
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	Reconstituted Complex	BioGRID	15210690
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	ERK1 interacts with and phosphorylates c-Myc.	BIND	9155018
MAPK7	BMK1 \| ERK4 \| ERK5 \| PRKM7	mitogen-activated protein kinase 7	-	HPRD	9461566
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	-	HPRD,BioGRID	10551811
MAX	MGC10775 \| MGC11225 \| MGC18164 \| MGC34679 \| MGC36767 \| bHLHd4 \| orf1	MYC associated factor X	Myc interacts with Max. This interaction was modeled on a demonstrated interaction between human Myc and Max from an unspecified source.	BIND	12584560
MAX	MGC10775 \| MGC11225 \| MGC18164 \| MGC34679 \| MGC36767 \| bHLHd4 \| orf1	MYC associated factor X	Affinity Capture-MS Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	2006410 \|9528857 \|9708738 \|10229200 \|10319872 \|10593926 \|10611234 \|12391307 \|12584560 \|17353931
MAX	MGC10775 \| MGC11225 \| MGC18164 \| MGC34679 \| MGC36767 \| bHLHd4 \| orf1	MYC associated factor X	-	HPRD	2006410 \|10229200
MCM7	CDABP0042 \| CDC47 \| MCM2 \| P1.1-MCM3 \| P1CDC47 \| P85MCM \| PNAS-146	minichromosome maintenance complex component 7	Affinity Capture-MS	BioGRID	17353931
MED12	CAGH45 \| HOPA \| KIAA0192 \| OPA1 \| TNRC11 \| TRAP230	mediator complex subunit 12	Reconstituted Complex	BioGRID	12660246
MED14	CRSP150 \| CRSP2 \| CSRP \| CXorf4 \| DRIP150 \| EXLM1 \| MGC104513 \| RGR1 \| TRAP170	mediator complex subunit 14	Reconstituted Complex	BioGRID	12660246
MINA	DKFZp762O1912 \| FLJ14393 \| MDIG \| MINA53 \| NO52	MYC induced nuclear antigen	-	HPRD	12091391
MIRHG1	C13orf25 \| FLJ14178 \| MGC126270 \| MIHG1 \| MIRH1 \| NCRNA00048	microRNA host gene 1 (non-protein coding)	Myc interacts with the mir-17 cluster locus	BIND	15944709
MKLN1	FLJ11162 \| TWA2	muskelin 1, intracellular mediator containing kelch motifs	Affinity Capture-MS	BioGRID	17353931
MLH1	COCA2 \| FCC2 \| HNPCC \| HNPCC2 \| MGC5172 \| hMLH1	mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)	-	HPRD,BioGRID	12584560
MLH1	COCA2 \| FCC2 \| HNPCC \| HNPCC2 \| MGC5172 \| hMLH1	mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)	MLH1 interacts with Myc.	BIND	12584560
MSH2	COCA1 \| FCC1 \| HNPCC \| HNPCC1 \| LCFS2	mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)	Affinity Capture-Western	BioGRID	12584560
MSH6	GTBP \| HNPCC5 \| HSAP	mutS homolog 6 (E. coli)	Affinity Capture-MS	BioGRID	17353931
MXD1	MAD \| MAD1 \| MGC104659	MAX dimerization protein 1	-	HPRD,BioGRID	11602341
MYBBP1A	FLJ37886 \| P160 \| PAP2	MYB binding protein (P160) 1a	Affinity Capture-MS	BioGRID	17353931
MYCBP	AMY-1	c-myc binding protein	-	HPRD,BioGRID	9797456
MYCBP2	DKFZp686M08244 \| FLJ10106 \| FLJ13826 \| FLJ21597 \| FLJ21646 \| KIAA0916 \| PAM	MYC binding protein 2	Myc interacts with Pam.	BIND	9689053
MYCBP2	DKFZp686M08244 \| FLJ10106 \| FLJ13826 \| FLJ21597 \| FLJ21646 \| KIAA0916 \| PAM	MYC binding protein 2	-	HPRD,BioGRID	9689053
MYO1B	myr1	myosin IB	Affinity Capture-MS	BioGRID	17353931
NCL	C23 \| FLJ45706	nucleolin	Ncl (nucleolin) interacts with Myc (c-Myc).	BIND	15674325
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	AIB1 interacts with c-myc promoter.	BIND	15808510
NFYB	CBF-A \| CBF-B \| HAP3 \| NF-YB	nuclear transcription factor Y, beta	-	HPRD,BioGRID	11282029
NFYB	CBF-A \| CBF-B \| HAP3 \| NF-YB	nuclear transcription factor Y, beta	Myc interacts with NF-YB. This interaction was modeled on a demonstrated interaction between human Myc and mouse NF-YB	BIND	11282029
NFYC	CBF-C \| CBFC \| DKFZp667G242 \| FLJ45775 \| H1TF2A \| HAP5 \| HSM \| NF-YC	nuclear transcription factor Y, gamma	Myc interacts with NF-YC.	BIND	11282029
NFYC	CBF-C \| CBFC \| DKFZp667G242 \| FLJ45775 \| H1TF2A \| HAP5 \| HSM \| NF-YC	nuclear transcription factor Y, gamma	-	HPRD,BioGRID	10446203
NMI	-	N-myc (and STAT) interactor	-	HPRD	8668343
NMI	-	N-myc (and STAT) interactor	Affinity Capture-Western Reconstituted Complex	BioGRID	11916966
NMI	-	N-myc (and STAT) interactor	Myc interacts with Nmi	BIND	11916966
NPM1	B23 \| MGC104254 \| NPM	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	Myc interacts with NPM1 (B23)	BIND	15944709
NUP205	C7orf14	nucleoporin 205kDa	Affinity Capture-MS	BioGRID	17353931
NUP93	KIAA0095 \| MGC21106	nucleoporin 93kDa	Affinity Capture-MS	BioGRID	17353931
ORC2L	ORC2	origin recognition complex, subunit 2-like (yeast)	Ocr2 interacts with C-Myc origin.	BIND	15910003
PARP10	FLJ14464	poly (ADP-ribose) polymerase family, member 10	PARP10 interacts with Myc (c-Myc)	BIND	15674325
PDS5A	DKFZp686B19246 \| FLJ41012 \| KIAA0648 \| MGC131948 \| MGC161503 \| PIG54 \| SCC-112	PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
PFDN5	MGC5329 \| MGC71907 \| MM-1 \| MM1 \| PFD5	prefoldin subunit 5	Reconstituted Complex Two-hybrid	BioGRID	9792694 \|11567024
PIAS2	MGC102682 \| MIZ1 \| PIASX \| PIASX-ALPHA \| PIASX-BETA \| SIZ2 \| ZMIZ4 \| miz	protein inhibitor of activated STAT, 2	Affinity Capture-Western	BioGRID	11283613
PMAIP1	APR \| NOXA	phorbol-12-myristate-13-acetate-induced protein 1	c-Myc interacts with NOXA promoter.	BIND	15856024
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	Myc interacts with PML. This interaction was modelled on a demonstrated interaction between mouse Myc and human PML.	BIND	15735755
POLE	DKFZp434F222 \| FLJ21434 \| POLE1	polymerase (DNA directed), epsilon	Affinity Capture-MS	BioGRID	17353931
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Pol II interacts with c-myc promoter.	BIND	15808510
POLR2A	MGC75453 \| POLR2 \| POLRA \| RPB1 \| RPBh1 \| RPO2 \| RPOL2 \| RpIILS \| hRPB220 \| hsRPB1	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	Reconstituted Complex	BioGRID	12660246
PRPF8	HPRP8 \| PRP8 \| PRPC8 \| RP13	PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	9315742
RAGE	MOK \| RAGE1	renal tumor antigen	-	HPRD,BioGRID	10421840
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	7838535
RBL1	CP107 \| MGC40006 \| PRB1 \| p107	retinoblastoma-like 1 (p107)	-	HPRD,BioGRID	8076603
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD,BioGRID	12027803
RIBIN	-	rRNA promoter binding protein	c-Myc interacts with rDNA.	BIND	15723054
RRM2B	DKFZp686M05248 \| MGC102856 \| MGC42116 \| p53R2	ribonucleotide reductase M2 B (TP53 inducible)	c-Myc interacts with p53R2 promoter.	BIND	15856024
RUVBL1	ECP54 \| INO80H \| NMP238 \| PONTIN \| Pontin52 \| RVB1 \| TIH1 \| TIP49 \| TIP49A	RuvB-like 1 (E. coli)	Affinity Capture-Western Co-purification Reconstituted Complex	BioGRID	11509179 \|11839798
RUVBL2	CGI-46 \| ECP51 \| INO80J \| REPTIN \| RVB2 \| TIH2 \| TIP48 \| TIP49B	RuvB-like 2 (E. coli)	Co-purification	BioGRID	11839798
SAP130	FLJ12761	Sin3A-associated protein, 130kDa	Co-purification Reconstituted Complex	BioGRID	12660246
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD,BioGRID	11804592
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD,BioGRID	11804592
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	Affinity Capture-MS Affinity Capture-Western	BioGRID	11839798 \|17353931
SMARCB1	BAF47 \| INI1 \| RDT \| SNF5 \| SNF5L1 \| Sfh1p \| Snr1 \| hSNFS	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	-	HPRD,BioGRID	10319872
SNRNP200	ASCC3L1 \| BRR2 \| HELIC2 \| U5-200KD	small nuclear ribonucleoprotein 200kDa (U5)	Affinity Capture-MS	BioGRID	17353931
SP1	-	Sp1 transcription factor	Myc interacts with Sp1. This interaction was modeled on a demonstrated interaction between mouse Myc and human Sp-1.	BIND	11274368
SP1	-	Sp1 transcription factor	Sp1 interacts with Myc.	BIND	15780936
SP1	-	Sp1 transcription factor	-	HPRD,BioGRID	11274368
SPAG9	FLJ13450 \| FLJ14006 \| FLJ26141 \| FLJ34602 \| HLC4 \| JLP \| KIAA0516 \| MGC117291 \| MGC14967 \| MGC74461 \| PHET \| PIG6	sperm associated antigen 9	-	HPRD	12391307
SUPT3H	SPT3 \| SPT3L	suppressor of Ty 3 homolog (S. cerevisiae)	-	HPRD,BioGRID	12660246
TADA2L	ADA2 \| ADA2A \| FLJ12705 \| KL04P \| hADA2	transcriptional adaptor 2 (ADA2 homolog, yeast)-like	Co-purification Reconstituted Complex	BioGRID	12660246
TADA3L	ADA3 \| FLJ20221 \| FLJ21329 \| hADA3	transcriptional adaptor 3 (NGG1 homolog, yeast)-like	Co-purification	BioGRID	12660246
TAF10	TAF2A \| TAF2H \| TAFII30	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	Co-purification	BioGRID	12660246
TAF12	TAF2J \| TAFII20	TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa	Co-purification	BioGRID	12660246
TAF1A	MGC:17061 \| RAFI48 \| SL1 \| TAFI48	TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa	TAFI48 interacts with c-Myc.	BIND	15723054
TAF1B	MGC:9349 \| RAF1B \| RAFI63 \| SL1 \| TAFI63	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	TAFI63 interacts with c-Myc.	BIND	15723054
TAF1C	MGC:39976 \| SL1 \| TAFI110 \| TAFI95	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	TAFI110 interacts with c-Myc.	BIND	15723054
TAF5	TAF2D \| TAFII100	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	Reconstituted Complex	BioGRID	12660246
TAF5L	PAF65B	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	Co-purification	BioGRID	12660246
TAF6L	FLJ11136 \| MGC4288 \| PAF65A	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	Co-purification	BioGRID	12660246
TAF9	AD-004 \| AK6 \| CGI-137 \| CINAP \| CIP \| MGC1603 \| MGC3647 \| MGC5067 \| MGC:1603 \| MGC:3647 \| MGC:5067 \| TAF2G \| TAFII31 \| TAFII32 \| TAFIID32	TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa	Affinity Capture-Western Co-purification Reconstituted Complex	BioGRID	12660246
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	Reconstituted Complex	BioGRID	8755740
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	TBP interacts with c-Myc.	BIND	15723054
TFAP2A	AP-2 \| AP-2alpha \| AP2TF \| BOFS \| TFAP2	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	Affinity Capture-Western Reconstituted Complex	BioGRID	7729426
TFAP2B	AP-2B \| AP2-B \| MGC21381	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	-	HPRD	7729426
TIAM1	FLJ36302	T-cell lymphoma invasion and metastasis 1	-	HPRD,BioGRID	12446731
TP73	P73	tumor protein p73	-	HPRD,BioGRID	12080043
TRRAP	FLJ10671 \| PAF350/400 \| PAF400 \| STAF40 \| TR-AP \| Tra1	transformation/transcription domain-associated protein	-	HPRD,BioGRID	9708738
TRRAP	FLJ10671 \| PAF350/400 \| PAF400 \| STAF40 \| TR-AP \| Tra1	transformation/transcription domain-associated protein	c-Myc interacts with TRRAP.	BIND	12660246
TUBA1A	B-ALPHA-1 \| FLJ25113 \| LIS3 \| TUBA3	tubulin, alpha 1a	-	HPRD	7651436
TUBA1B	K-ALPHA-1	tubulin, alpha 1b	-	HPRD	7651436
TUBA3C	TUBA2 \| bA408E5.3	tubulin, alpha 3c	-	HPRD	7651436
TUBA4A	FLJ30169 \| H2-ALPHA \| TUBA1	tubulin, alpha 4a	-	HPRD	7651436
TUBA8	TUBAL2	tubulin, alpha 8	-	HPRD	7651436
XRCC5	FLJ39089 \| KARP-1 \| KARP1 \| KU80 \| KUB2 \| Ku86 \| NFIV	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	Ku80 interacts with C-Myc origin.	BIND	15910003
YY1	DELTA \| INO80S \| NF-E1 \| UCRBP \| YIN-YANG-1	YY1 transcription factor	-	HPRD,BioGRID	8266081
ZBTB17	MIZ-1 \| ZNF151 \| ZNF60 \| pHZ-67	zinc finger and BTB domain containing 17	-	HPRD,BioGRID	9312026

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG TGF BETA SIGNALING PATHWAY	86	64	All SZGR 2.0 genes in this pathway
KEGG JAK STAT SIGNALING PATHWAY	155	105	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG COLORECTAL CANCER	62	47	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG THYROID CANCER	29	26	All SZGR 2.0 genes in this pathway
KEGG BLADDER CANCER	42	33	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG ACUTE MYELOID LEUKEMIA	60	47	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
BIOCARTA CDMAC PATHWAY	16	15	All SZGR 2.0 genes in this pathway
BIOCARTA CTCF PATHWAY	23	18	All SZGR 2.0 genes in this pathway
BIOCARTA ERK PATHWAY	28	22	All SZGR 2.0 genes in this pathway
BIOCARTA IL2RB PATHWAY	38	26	All SZGR 2.0 genes in this pathway
BIOCARTA GLEEVEC PATHWAY	23	17	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
BIOCARTA PPARA PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA VIP PATHWAY	29	26	All SZGR 2.0 genes in this pathway
BIOCARTA P38MAPK PATHWAY	40	31	All SZGR 2.0 genes in this pathway
BIOCARTA CARDIACEGF PATHWAY	18	16	All SZGR 2.0 genes in this pathway
BIOCARTA TEL PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA ARF PATHWAY	17	13	All SZGR 2.0 genes in this pathway
BIOCARTA WNT PATHWAY	26	24	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID NOTCH PATHWAY	59	49	All SZGR 2.0 genes in this pathway
PID P73PATHWAY	79	59	All SZGR 2.0 genes in this pathway
PID E2F PATHWAY	74	48	All SZGR 2.0 genes in this pathway
PID CD40 PATHWAY	31	26	All SZGR 2.0 genes in this pathway
PID MYC ACTIV PATHWAY	79	62	All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY	46	39	All SZGR 2.0 genes in this pathway
PID LKB1 PATHWAY	47	37	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
PID IL2 1PATHWAY	55	43	All SZGR 2.0 genes in this pathway
PID MYC PATHWAY	25	22	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID CERAMIDE PATHWAY	48	37	All SZGR 2.0 genes in this pathway
PID AP1 PATHWAY	70	60	All SZGR 2.0 genes in this pathway
PID FOXM1 PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID IL6 7 PATHWAY	47	40	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY	65	37	All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME NOTCH1 INTRACELLULAR DOMAIN REGULATES TRANSCRIPTION	46	28	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH1	70	46	All SZGR 2.0 genes in this pathway
REACTOME SMAD2 SMAD3 SMAD4 HETEROTRIMER REGULATES TRANSCRIPTION	27	17	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL ACTIVITY OF SMAD2 SMAD3 SMAD4 HETEROTRIMER	38	26	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE MITOTIC	325	185	All SZGR 2.0 genes in this pathway
REACTOME CYCLIN E ASSOCIATED EVENTS DURING G1 S TRANSITION	65	40	All SZGR 2.0 genes in this pathway
REACTOME G1 S TRANSITION	112	63	All SZGR 2.0 genes in this pathway
REACTOME MITOTIC G1 G1 S PHASES	137	79	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH	103	64	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY TGF BETA RECEPTOR COMPLEX	63	42	All SZGR 2.0 genes in this pathway
REACTOME S PHASE	109	66	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE UP	79	50	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR UP	55	34	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
NAGASHIMA EGF SIGNALING UP	58	40	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN	209	122	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR DN	64	39	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR DN	75	50	All SZGR 2.0 genes in this pathway
LAU APOPTOSIS CDKN2A UP	55	40	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA REVERSIBLY DN	29	21	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN	229	142	All SZGR 2.0 genes in this pathway
CHIN BREAST CANCER COPY NUMBER UP	27	18	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN DN	172	112	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP	536	340	All SZGR 2.0 genes in this pathway
TAKADA GASTRIC CANCER COPY NUMBER UP	7	5	All SZGR 2.0 genes in this pathway
NUNODA RESPONSE TO DASATINIB IMATINIB UP	29	20	All SZGR 2.0 genes in this pathway
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN	45	34	All SZGR 2.0 genes in this pathway
TURJANSKI MAPK1 AND MAPK2 TARGETS	12	10	All SZGR 2.0 genes in this pathway
TURJANSKI MAPK7 TARGETS	8	8	All SZGR 2.0 genes in this pathway
MAHADEVAN RESPONSE TO MP470 DN	19	11	All SZGR 2.0 genes in this pathway
BAKER HEMATOPOESIS STAT1 TARGETS	10	9	All SZGR 2.0 genes in this pathway
BAKER HEMATOPOIESIS STAT3 TARGETS	16	12	All SZGR 2.0 genes in this pathway
BAKER HEMATOPOESIS STAT5 TARGETS	7	7	All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION UP	88	58	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS AND SERUM RESPONSE DN	47	34	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS AND SERUM RESPONSE UP	47	32	All SZGR 2.0 genes in this pathway
DIRMEIER LMP1 RESPONSE EARLY	66	48	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
AMUNDSON GENOTOXIC SIGNATURE	105	68	All SZGR 2.0 genes in this pathway
FUNG IL2 SIGNALING 2	12	8	All SZGR 2.0 genes in this pathway
FUNG IL2 TARGETS WITH STAT5 BINDING SITES T1	9	7	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP	176	111	All SZGR 2.0 genes in this pathway
MANN RESPONSE TO AMIFOSTINE UP	20	12	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL UP	83	51	All SZGR 2.0 genes in this pathway
WOOD EBV EBNA1 TARGETS UP	110	71	All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP	380	213	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN	203	134	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 DN	51	42	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE NORMAL DN	33	27	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE IMMORTALIZED DN	31	26	All SZGR 2.0 genes in this pathway
CEBALLOS TARGETS OF TP53 AND MYC UP	21	16	All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS UP	201	127	All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION	149	101	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 DN	156	106	All SZGR 2.0 genes in this pathway
MANTOVANI NFKB TARGETS UP	43	33	All SZGR 2.0 genes in this pathway
MANTOVANI VIRAL GPCR SIGNALING UP	86	54	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
SCIAN CELL CYCLE TARGETS OF TP53 AND TP73 DN	22	14	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC UP	33	20	All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN	206	136	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 2	30	23	All SZGR 2.0 genes in this pathway
COLLIS PRKDC SUBSTRATES	20	15	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 8Q23 Q24 AMPLICON	157	87	All SZGR 2.0 genes in this pathway
TESAR ALK TARGETS HUMAN ES 5D DN	7	5	All SZGR 2.0 genes in this pathway
NELSON RESPONSE TO ANDROGEN DN	19	14	All SZGR 2.0 genes in this pathway
TENEDINI MEGAKARYOCYTE MARKERS	66	48	All SZGR 2.0 genes in this pathway
SCHUHMACHER MYC TARGETS UP	80	57	All SZGR 2.0 genes in this pathway
DORSAM HOXA9 TARGETS DN	32	22	All SZGR 2.0 genes in this pathway
PEART HDAC PROLIFERATION CLUSTER DN	76	57	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR DN	25	15	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE UP	203	130	All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION	88	68	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 DN	51	32	All SZGR 2.0 genes in this pathway
HOFMANN CELL LYMPHOMA UP	50	35	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION DN	87	57	All SZGR 2.0 genes in this pathway
RORIE TARGETS OF EWSR1 FLI1 FUSION UP	30	22	All SZGR 2.0 genes in this pathway
TAVOR CEBPA TARGETS DN	30	21	All SZGR 2.0 genes in this pathway
JAIN NFKB SIGNALING	75	44	All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN	86	67	All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA DN	19	14	All SZGR 2.0 genes in this pathway
XU RESPONSE TO TRETINOIN AND NSC682994 DN	15	12	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C8	72	56	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND H2O2	39	29	All SZGR 2.0 genes in this pathway
ZHENG RESPONSE TO ARSENITE DN	18	15	All SZGR 2.0 genes in this pathway
MCDOWELL ACUTE LUNG INJURY UP	45	29	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY UP	86	48	All SZGR 2.0 genes in this pathway
WU HBX TARGETS 3 UP	18	11	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN	123	86	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR DN	47	31	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
MOREIRA RESPONSE TO TSA UP	28	23	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO CANTHARIDIN DN	69	46	All SZGR 2.0 genes in this pathway
HENDRICKS SMARCA4 TARGETS DN	53	34	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 2HR	51	36	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 1	33	24	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2	163	113	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC UP	202	115	All SZGR 2.0 genes in this pathway
VARELA ZMPSTE24 TARGETS UP	40	30	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C5	46	36	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN	141	92	All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN	271	175	All SZGR 2.0 genes in this pathway
TRACEY RESISTANCE TO IFNA2 DN	32	23	All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A UP	81	52	All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE	206	117	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4	307	185	All SZGR 2.0 genes in this pathway
LEIN MEDULLA MARKERS	81	48	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T4	94	69	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED	728	415	All SZGR 2.0 genes in this pathway
MARSON FOXP3 CORE DIRECT TARGETS	19	14	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS	212	121	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC	210	123	All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC	58	43	All SZGR 2.0 genes in this pathway
HELLER SILENCED BY METHYLATION DN	105	67	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN	281	179	All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G	171	96	All SZGR 2.0 genes in this pathway
LIN MELANOMA COPY NUMBER UP	73	53	All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER UP	20	14	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING UP	115	80	All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA	51	35	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN DN	249	165	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP	285	167	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
CLIMENT BREAST CANCER COPY NUMBER UP	23	20	All SZGR 2.0 genes in this pathway
CONRAD STEM CELL	39	27	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA DN	100	63	All SZGR 2.0 genes in this pathway
TAYLOR METHYLATED IN ACUTE LYMPHOBLASTIC LEUKEMIA	77	52	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN	210	128	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D UP	89	62	All SZGR 2.0 genes in this pathway
CHAUHAN RESPONSE TO METHOXYESTRADIOL UP	51	32	All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO SERM OR FULVESTRANT DN	50	29	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS DN	74	50	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER BRCA1 UP	36	18	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP	298	174	All SZGR 2.0 genes in this pathway
SHAFFER IRF4 MULTIPLE MYELOMA PROGRAM	36	25	All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE	101	76	All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN ACTIVATED B LYMPHOCYTE	81	66	All SZGR 2.0 genes in this pathway
ZHAN EARLY DIFFERENTIATION GENES DN	42	29	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS DN	54	38	All SZGR 2.0 genes in this pathway
FONTAINE FOLLICULAR THYROID ADENOMA DN	68	45	All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP	83	63	All SZGR 2.0 genes in this pathway
CHIARETTI T ALL RELAPSE PROGNOSIS	19	15	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS DN	31	25	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 12HR DN	33	25	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 24HR UP	12	6	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 32HR UP	11	7	All SZGR 2.0 genes in this pathway
DORN ADENOVIRUS INFECTION 48HR UP	14	9	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 8	49	36	All SZGR 2.0 genes in this pathway
NAKAMURA ADIPOGENESIS EARLY UP	66	44	All SZGR 2.0 genes in this pathway
NAKAMURA ADIPOGENESIS LATE UP	104	67	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 2HR DN	49	33	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN	374	217	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
ACOSTA PROLIFERATION INDEPENDENT MYC TARGETS DN	116	74	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
DUAN PRDM5 TARGETS	79	52	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
JUBAN TARGETS OF SPI1 AND FLI1 DN	92	60	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN	114	69	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-34b	138	144	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-496	281	287	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MYC